Labshake search
Citations for PerkinElmer :
301 - 350 of 1198 citations for 5 5 7 7 Tetramethyl 1 5 6 7 tetrahydrocyclopenta f indazol 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 the luciferase activity was measured on Centro LB 960 Microplate Luminometer (Berthold Technologies) using Britelite PlusTM (PerkinElmer) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 24-well plates for 2 h with 0.25 ml/well of fresh growth medium containing 5 μCi/ml [3H]adenine (PerkinElmer). The medium was then replaced with 0.5 ml/well of DMEM containing 20 mM HEPES ...
-
bioRxiv - Molecular Biology 2023Quote: ... with a total length of 109 ntb was prepared by 5′-end-labelling using [γ-32P]- ATP (Perkin Elmer) and T4 polynucleotide kinase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified RNA oligos were either phosphorylated with unlabeled ATP or 5’ end-labeled using [γ-32P] ATP (Perkin Elmer) and T4-Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Genomics 2023Quote: ... The metabolite extract was transferred into scintillation vials with 5 mL Insta-Gel Plus scintillation cocktail (Perkin Elmer #601339).
-
bioRxiv - Neuroscience 2024Quote: ... we administered four intraperitoneal injections of 3H-Thy at 2 hrs intervals to adult mice (1.67 μL/g body weight, specific activity 5 Ci/mmol; PerkinElmer) with subsequent perfusion 2 hrs after the last injection (n = 3) ...
-
bioRxiv - Microbiology 2024Quote: Overnight cultures were diluted to an OD600 of ∼0.05 in 10 mL LB Miller broth supplemented with 5 µCi/mL 32P ortho-phosphoric acid (PerkinElmer) and grown until reaching an OD600 of ∼0.6 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... collected water samples (45 ml in 50 ml Falcon tubes, with small aerobic headspace) were spiked with 5 µCi of NaH14CO3 (Perkin Elmer, specific activity 56 mCi mmol−1). The samples were incubated for 24 h at ∼ 20 °C in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... the plates containing infected macrophages were incubated at 37°C with 5% CO2 for 18 h in an Operetta High-Content Imaging System (PerkinElmer). During this 18 h incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were incubated for 5 minutes at 37°C with 55µCi/well of 35S-L-methionine and 35S-L-cysteine Promix (Perkin Elmer) in a minimal volume of culture medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cell motility was acquired using temperature (37°C) and CO2 (5%) controlled Operetta CLS High-Content Analysis System (PerkinElmer, HH16000000) (non-confocal ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Spectra were analysed using OPUS 6.5 software (Bruker) and compared with RMIT University’s spectral library of organic compounds generated using Spectrum 10 software (Perkin Elmer). Fingerprint spectra shown in Figure 4D were prepared using GraphPad Prism.
-
bioRxiv - Microbiology 2021Quote: ... 1.37 μg/mL of RBD and 5 μg/mL of Ecto) and incubated overnight in protein-binding 96-well plates (PerkinElmer). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... plates were centrifuged once more under same conditions mentioned above and 5 µL of each FRET antibody pair was added (2.5 nM final concentration for donor and 5 nM for acceptor, diluted in 1x Lance buffer, (Perkin Elmer)) ...
-
bioRxiv - Microbiology 2021Quote: ... and fluorescence at 355 nm excitation and 460 nm emission was monitored every 5 minutes for 50 minutes using an Envision plate reader (PerkinElmer). Rate of substrate cleavage was determined using linear regression of the raw data values obtained during the time course ...
-
bioRxiv - Microbiology 2022Quote: ... was phosphorylated in vitro with His-MBP-PknBMtb at 0.015 μg/μl for 30 minutes at room temperature with 0.15μCi/μl ATP [γ-32P] (5×10-8 μmol) (3000Ci/mmol, 10mCi/ml, PerkinElmer BLU002A250UC) and 2mM MnCl2 in buffer (50mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... Nifene or nicotine respectively for 5 min followed by addition of 2.5 nM [125I]-epibatidine ([125I]Epb) (2200 Ci/mmol; Perkin Elmer) and incubation for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Emission intensity was recorded for 5 min using 460 nm and 530 nm filters on the EnVision or Victor X Light plate reader (PerkinElmer). Next ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.05□μl of 5□mM stock compounds in DMSO were dispensed into assay microplates with a Janus 384 MDT NanoHead (PerkinElmer). Final concentration of the screening compounds in the assay was 16LμM ...
-
bioRxiv - Neuroscience 2023Quote: ... Live cell imaging was performed at 37°C in 5% CO2 for 24 hours using the Opera Phenix High Content Screening System (PerkinElmer). Acquired images were analyzed by using the Harmony software (PerkinElmer).
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed with the DNA absorption solution (for one sample: 50 uL 5 M NaCl, 15 ul magnetic beads (GMG-252-A-100mL – PerkinElmer), 250 uL 7.8 M guanidium chloride ...
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Immunology 2024Quote: ... of luciferase activity in each well was measured within 5 min after the addition of substrate using a Victor X4 plate reader (PerkinElmer). After subtracting background luciferase activity in uninfected cells ...
-
bioRxiv - Immunology 2024Quote: ... Fluoforte® fluorescence (excitation 490 nM/emission 525 nM) was quantified at time 0 (baseline) and after 5 minutes on an Envision plate reader (PerkinElmer). Normalized relative fluorescence units (ΔRFU ...
-
bioRxiv - Cell Biology 2024Quote: ... Tem1 (3.3 µM final concentration) was mixed with GTP (33 µM final) supplemented with 5 µCi [α-32P]-GTP (PerkinElmer) in the reaction buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Filters with the bound radioligand were transferred to vials containing 5 mL of Ultima Gold cocktail (PerkinElmer, Boston, MA, USA) and measured with a Packard Tri-Carb 2200CA liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Microtubes were then centrifuged at 1000g for 5 min and radiolabeled lipids were counted in the upper phase with a Tri-Carb 4910TR liquid scintillation counter (PerkinElmer). Results were normalized to total protein content and expressed in comparison to control cells.
-
bioRxiv - Microbiology 2024Quote: ... The bacterial mCherry signal was measured on day 0 and day 5 post infection on an Envision plate reader (PerkinElmer). Oleate was maintained throughout the experiment in the rescue assay conditions.
-
bioRxiv - Systems Biology 2024Quote: ... They were then incubated with 0.5 ml of uptake solution containing [3H]glutamine (5 μCi/ml; Perkin Elmer, NET 55100) in either the presence ...
-
bioRxiv - Immunology 2024Quote: ... diluted 1:40 in assay diluent 5 and then IL-1β levels were measured using the Human IL- 1β HTRF kit (Cisbio – PerkinElmer), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Microtubes were centrifuged at 1000g for 5 min and radiolabeled lipids were counted in the upper phase with a Tri-Carb 4910TR liquid scintillation counter (PerkinElmer). Results were normalized to cell number as described for oxygen consumption.
-
bioRxiv - Genetics 2024Quote: ... Plates were incubated on a plate rocker for 5 min and luminescence read using a 400 to 700-nm filter equipped to an EnVision Plate Reader (PerkinElmer).
-
bioRxiv - Biophysics 2024Quote: ... 750 µl of lysed cells) were transferred to a scintillation vial with 5 ml of scintillation cocktail (Perkin Elmer, 6013327). Radioactivity was measured with a liquid scintillation analyzer (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metastatic outgrowth was longitudinally followed in vivo by intraperitoneal injection of luciferin (5 μg/kg) and imaging with IVIS Lumina III (PerkinElmer) (Garcia-Leon et al. ...