Labshake search
Citations for PerkinElmer :
301 - 350 of 661 citations for 4' Bromo 3' fluoro 2 morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Each mouse received 2 nmol of MMPSense 680 (150 μl; Perkin Elmer, France) or Cat K 680 FAST™ (100 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added to the wells before addition of 2-[3H]deoxyglucose (2DG) (PerkinElmer). During the final 5 min 2DG (0.25 μCi ...
-
bioRxiv - Cancer Biology 2020Quote: ... and imaged/analysed using the Vectra 2 System (PerkinElmer Inc., Waltham, MA, USA). The RAD51 Vectra score (RAD51Vs ...
-
bioRxiv - Neuroscience 2021Quote: ... and HPLC fractions were counted with automatic gamma well-counter (Wizard 2, PerkinElmer). The sample recovery rate ...
-
bioRxiv - Plant Biology 2023Quote: ... and 750 nm using a spectrophotometer (Perkin Elmer UV/VIS spectrometer Lambda 2). The pigment contents were calculated according to the equation given by Wellburn ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human IL-2 concentration was measured with the AlphaLISA human IL2 Kit (PerkinElmer) and data collected on an Envision Plate Reader (PerkinElmer) ...
-
bioRxiv - Cell Biology 2023Quote: ... Luminescence signal was read by Wallac 1420 Victor 2 (Perkin Elmer, Waltham, MA) or Synergy h1 microplate reader (BioTek ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 mM EDTA and 2-[125I]-MLT as radioligand (PerkinElmer, Waltham, MA, USA), using membranes extracted from HEK293 cells stably expressing human MT1 or MT2 receptors ...
-
bioRxiv - Bioengineering 2022Quote: ... Activity in all samples was assessed via gamma counter (Wizard 2, Perkin Elmer) once decayed to a linear range ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then read in a Wallac Victor 2 fluorimeter (Perkin Elmer) with excitation at 355 nm ...
-
bioRxiv - Cancer Biology 2023Quote: ... blots were developed in 2 mL Western Lighting Plus chemiluminescent substrate (Perkin Elmer) and imaged on the ImageQuant LAS4000 (Cytiva).
-
bioRxiv - Biochemistry 2024Quote: ... [1-3H] RuBP was synthetized enzymatically from D-[2-3H] glucose (PerkinElmer, MA) following published protocols47 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and D-[14C(U)] glucose (2 µCi/mL; Perkin Elmer, Cat: #NEC042V250UC, US) were diluted in DPBS supplemented with 10 mM HEPES (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... we used THP-1 cells (4×105 cells/ml) adhered in an optical 96-well plate (PerkinElmer) with 50 ng/ml phorbol 12-myristate 13-acetate (PMA ...
-
bioRxiv - Cell Biology 2020Quote: ... 300 μl of each supernatant were mixed with 4 ml of Ultima Gold liquid scintillation cocktail (PerkinElmer) and run on a Hidex SL300 counter ...
-
bioRxiv - Plant Biology 2023Quote: ... The same seeds were transferred into weighing cup and weighed with an AD-4 Autobalance (PerkinElmer, Inc.). Single seed weight was subsequently determined by dividing the total weight by the number of seeds.
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Neuroscience 2021Quote: ... The signal of CB1 receptor hybridization was revealed by a TSA reaction using cyanine 3 (Cy3)-labeled tyramide (1:100 for 10 minutes, NEL744001KT PerkinElmer). After several washes ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was performed using the either the TSA Cyanine 3 Plus or the TSA Plus Fluorescein Evaluation Kits (Perkin Elmer).
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Microbiology 2022Quote: ... 48 hpi liver-stage cultures were washed with PBS and lysed in Nano-Glo Luciferase Assay buffer containing Nano-Glo Luciferase Assay substrate diluted 1:200 and luminescence was measured after 3 minutes on an IVIS Specturum CT (PerkinElmer). To monitor merosome detachment at 65 hpi ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Cell Biology 2022Quote: ... Hybridization signals were detected by a chromogenic reaction using red chromogen dilution 1:3000 (PerkinElmer TSA Plus Cyanine 3 System). RNA-staining signal was identified as red punctate dots and clusters ...
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Cell Biology 2024Quote: ... Fresh mouse cardiac biopsies (1 biopsy ∼1-3 mg/well) were distributed in a 96-well white microplate (OptiPlate-96; PerkinElmer) and incubated or not (basal ...
-
bioRxiv - Cell Biology 2024Quote: The glucose uptake was determined by seeding hBMSCs (passage 3) in a 96-well black/clear bottom plate (Perkin Elmer) at a density of 6,000 cells/well (6 wells/group) ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 pseudovirus productions were quantified by p24 ELISA (Perkin Elmer Life Sciences).
-
bioRxiv - Biochemistry 2020Quote: ... 2 μM mononucleosomes and 5.0 μM S-[methyl-14C]-adenosyl-l-methionine (PerkinElmer, #NEC363050UC) in the presence or absence of stimulatory or control peptides in concentrations as indicated in the text ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... which contains inhibitors and 1 μCi D-[2-3H]-glucose (23.4 Ci/mmol, PerkinElmer). After 30 s’ reaction ...
-
bioRxiv - Physiology 2020Quote: ... 0.35 ml of transport solution with 0.5 µCi/ml [3H]2-deoxy-glucose (PerkinElmer) was added to the cells for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli tRNA nucleotidyltransferase and [α-32P] ATP (final activity 2 µCi/µL) (PerkinElmer, # BLU003X250UC) in 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 pseudovirus productions were quantified by p24 ELISA (Perkin Elmer Life Sciences).
-
bioRxiv - Physiology 2023Quote: ... a bolus injection of 2-[1,2-3H(N)]deoxy-D-glucose (PerkinElmer, Boston, Massachusetts) (0.4 μCi/g body weight ...
-
bioRxiv - Cell Biology 2023Quote: ... The colorimetric reaction was read by Wallac 1420 Victor 2 (Perkin Elmer, Waltham, MA) or Synergy H1 microplate reader (BioTek ...