Labshake search
Citations for PerkinElmer :
301 - 350 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Nextflex bisulfite-seq barcodes (Catalogue Number: Nova-511913, PerkinElmer) were used as the adapters with incubation at 25°C for 30 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... 96-well plates (Pheno Plate 96-well microplates, PerkinElmer) were prepared for tissue seeding and culture by treatment with 100 μl of 5 % Pluronic F-127 (Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were transferred to nitrocellulose membrane (Schleicher and Schuell, PerkinElmer, Waltham, MA, USA), blocked in 10% non-fat milk ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were transferred to nitrocellulose membrane (Schleicher and Schuell, PerkinElmer, Waltham, MA, USA) using Trans-Blot® Turbo™ Transfer System (Bio-Rad) ...
-
bioRxiv - Immunology 2024Quote: ... Antibody binding was detected using enhanced chemiluminescent substrates for horseradish peroxidase (HRP) (ECL Western blotting reagents (PerkinElmer, cat: NEL105001EA) or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: High-content imaging was performed on the Opera Phenix high-content screening system (PerkinElmer) using a 63x water immersion objective ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of nascent RNA was used as input to construct plaNETseq libraries using NEXTflex Small RNA-seq kit v3 (PerkinElmer) with a modified protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Imaging was performed on an Ultraview Vox spinning disk confocal system running Volocity software (PerkinElmer) using the 20×/0.75 NA UPlanSApo objective on an Olympus IX81 inverted microscope equipped with an electron multiplying charge coupled device (EM-CCD ...
-
bioRxiv - Cancer Biology 2024Quote: ... Change in initial ATP concentration was measured as bioluminescence readout in counts per second on the Envision plate reader (PerkinElmer).
-
bioRxiv - Cancer Biology 2024Quote: ... and read in an EnVision Multilabel Plate Reader (Perkin Elmer, USA). Compound A-769662 (Cayman Chemical ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eµ-Myc lymphoma cells grown in 6-well plates were spiked with 0.2 μCi/mL [1-14C]-acetate (PerkinElmer; NEC084H001MC) for the final 4 h of the experimental period ...
-
bioRxiv - Microbiology 2024Quote: ... and the uptake of 14C(U) l-arginine was measured in the bacterial lysates using a liquid scintillation counter (Perkin Elmer).
-
bioRxiv - Immunology 2024Quote: ... 10 μl were transferred into a well containing 90 μl of SGal-URA of a 96-well optically clear flat-bottom plate (PerkinElmer 6055302). Data analysis of the high content imaging was performed in Fiji ...
-
bioRxiv - Biochemistry 2024Quote: ... 150 mM NaCl with 1 mg/ml CuYSi beads (Perkin Elmer). Protein concentration was estimated using FSEC and a standard GFP concentration curve ...
-
bioRxiv - Microbiology 2024Quote: ... The absorbance of the mixture was measured at 540 nm wavelength using a multimode plate reader (PerkinElmer). The concentration of NO was quantified using a standard curve ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were treated with 1 μM [1-14C]-oleic acid (PerkinElmer) diluted in high glucose DMEM containing 0.05% BSA for 1h ...
-
bioRxiv - Genetics 2024Quote: Genomic DNA of blood donors was extracted on a Chemagic MSM I extraction robot (Chemagen, Perkin Elmer). High-throughput genotyping of 46 blood group antigens of 35,954 donor samples collected in the years 2015 to 2021 was performed by MALDI-TOF MS as described previously [16,17] ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3H-2-deoxyglucose (Perkin Elmer, Waltham, MA) was measured as carried out previously(30 ...
-
bioRxiv - Developmental Biology 2024Quote: ... the tyramide signal amplification method with minor modifications was used according to the manufacturer’s instructions (NEL753001KT, PerkinElmer). The following antisense riboprobes were used ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The plates were further incubated for 20 min at room temperature and counted using the Wallac TriLux Microbeta counter (PerkinElmer). The results were analysed using GraphPad Prism 9.1 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the fluorescence transfer is measured at λex=337 nm and λem=620 and 665 nm using a microplate reader (Envison, Perkin Elmer). The cAMP concentration is determined by dividing the signal measured at 665 nm by that measured at 620 nm (ratio) ...
-
bioRxiv - Plant Biology 2024Quote: ... Fluorescence was detected by the use of a Wallac 1420 VICTOR2 microplate luminometer (PerkinElmer) using an excitation wavelength of 365 nm and a filter wavelength of 430 nm ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Absorbance was read at 585nm using Wallac 1420 Victor2 microplate reader (Perkin Elmer). Wells without cells were used as background and subtracted from the absorbance data ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 24-well plates for 2 h with 0.25 ml/well of fresh growth medium containing 5 μCi/ml [3H]adenine (PerkinElmer). The medium was then replaced with 0.5 ml/well of DMEM containing 20 mM HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... Pellets were resuspended in water and analyzed with a NexION 2000B single quadropole ICP-MS (PerkinElmer, Waltham, MA). A Meinhard nebulizer was used with a cyclonic glass spray chamber for the introduction of the sample ...
-
bioRxiv - Cell Biology 2024Quote: ... Z-stack images were subjected to deconvolution (iterative restoration) with Volocity software (Perkin Elmer) using the theoretical point-spread function for spinning-disk confocal microscopy ...
-
bioRxiv - Cancer Biology 2024Quote: ... images of both dorsal and ventral positions were captured using IVIS Spectrum In Vivo Imaging System (Perkin Elmer) under anesthesia ...
-
bioRxiv - Cancer Biology 2024Quote: ... Images were acquired with the High Content Analysis System Operetta CLS (PerkinElmer) with temperature (37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... They were acquired in several planes and the area analyses were performed on maximum projections by Harmony software (PerkinElmer). Volumetric analyses were performed by stack processing with 3d analysis.
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... The membrane was then imaged using chemiluminescent buffer (Perkin Elmer Western Lightning Plus ECL) and an Amersham 600UV (GE ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... Samples were resuspended in Optimem with a 1:1000 dilution of APC conjugated to anti-Flag (PerkinElmer) and 1:500 dilution Alexa Flour 488 conjugated to anti-HA (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... on a Sciclone G3 NGSx workstation (PerkinElmer, Waltham, MA, USA) using the TruSeq RNA protocol v2 (Illumina Part # 15026495 Rev.F ...
-
bioRxiv - Biochemistry 2024Quote: ... Master mixes of each reaction incubated for 30min at room temp in the dark before being loaded into 384 well flat black plate (PerkinElmer) and scanning each well 20 times on a Tecan Spark plate reader at 488 nm excitation and 530 nm emission ...
-
bioRxiv - Biochemistry 2024Quote: ... Fluorescence signals were acquired at room temperature in a Victor Nivo multimode fluorescent plate reader (Perkin Elmer) using an excitation filter at 320 nm and emission filters at 615 and 665 nm ...
-
bioRxiv - Biochemistry 2024Quote: ... Acceptor mixtures were prepared by mixing ULight alpha-6xHIS acceptor antibody (Perkin Elmer) with 6xHIS-tagged Swc5 variants at a ratio of 1:20 and serially diluting across 13 concentrations in H66 buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... 2x donor mixtures were prepared by mixing 4 nM streptavidin-Eu (Perkin Elmer) with or without 2 nM yeast nucleosomes containing 177 bp of Widom 601 DNA (31+145+1 ...
-
bioRxiv - Cell Biology 2024Quote: ... increasing concentrations of carbachol (from 0.01 µM up to 10 µM) were used in presence of 200 pM [3H]N-Methylscopolamine ([3H]NMS; 78.9 Ci/mmol; PerkinElmer).
-
bioRxiv - Cell Biology 2024Quote: Transfected COS-7 cells were incubated with myo-[3H]inositol (23 Ci/mmol; PerkinElmer) for 48 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were scanned on the Vectra Polaris Automated Quantitative Pathology Imaging System (PerkinElmer, Waltham,US) for quantification by Visiopharm platform (Visiopharm ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100 mg/kg RediJect D-Luciferin (PerkinElmer 770504) was injected intraperitoneally into mice followed by imaging on the IVIS Lumina III imaging system (Xenogen ...
-
bioRxiv - Cell Biology 2024Quote: ... an Orca R2 CCD camera (Hamamatsu) and Volocity software (PerkinElmer).
-
bioRxiv - Cell Biology 2024Quote: ... The fluorescence images were captured and the intensity of fluorescence was quantified with Living Image software (PerkinElmer, USA) [28].
-
bioRxiv - Cell Biology 2024Quote: ... Pearson’s colocalisation coefficients were determined using Volocity 6.3.1 software (PerkinElmer) with automatic Costes background thresholding ...
-
bioRxiv - Cell Biology 2024Quote: ... Image analyses were performed using Volocity 6.3 software (PerkinElmer, Waltham, MA, USA).
-
bioRxiv - Cell Biology 2024Quote: ... C57BL/6J mice were injected with labeled AT-EVs via the tail vein and then examined under anesthesia by the IVIS Spectrum in vivo imaging system (PerkinElmer, USA) at 24 h post-injection ...
-
bioRxiv - Cell Biology 2024Quote: ... high-content non-confocal imaging was performed using the Opera Phenix High-Content Screening System (Perkin Elmer) with a 20× water immersion lens and 568-nm lasers ...
-
bioRxiv - Cell Biology 2024Quote: ... Acquired images were analyzed using Harmony analytical software (v4.9, Perkin Elmer). Optical correction was performed using flat-field and bright-field correction ...
-
bioRxiv - Cell Biology 2024Quote: ... transfected cells were harvested using phenol red-free DMEM and seeded at a density of 1.0 × 104 cells/well onto CellCarrierTM-96 Ultra microplates (Perkin Elmer, Waltham, MA). Then ...
-
bioRxiv - Immunology 2024Quote: ... cells were lysed with Britelite Plus reagent (Perkin Elmer), and luciferase activity was measured as relative luminesce units (RLUs) ...