Labshake search
Citations for PerkinElmer :
251 - 300 of 320 citations for Glypican 3 GPC3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 48 hpi liver-stage cultures were washed with PBS and lysed in Nano-Glo Luciferase Assay buffer containing Nano-Glo Luciferase Assay substrate diluted 1:200 and luminescence was measured after 3 minutes on an IVIS Specturum CT (PerkinElmer). To monitor merosome detachment at 65 hpi ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Cell Biology 2022Quote: ... Hybridization signals were detected by a chromogenic reaction using red chromogen dilution 1:3000 (PerkinElmer TSA Plus Cyanine 3 System). RNA-staining signal was identified as red punctate dots and clusters ...
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 OD600 units of early log phase cells were labeled with 80 mCi of L-[35S]-methionine/cysteine mix (Perkin Elmer). Immunoprecipitated proteins were separated on SDS-PAGE and exposed to phosphor screens ...
-
bioRxiv - Cancer Biology 2020Quote: ... the extent of lung metastasis was measured every 3 days for 12 days using non-invasive imaging with IVIS Lumina III (Perkin Elmer). In brief ...
-
bioRxiv - Developmental Biology 2019Quote: ... were used to detect labeled probes by fluorophore deposition (Fluorescein or Cyanine 3) using the TSA Plus System (Perkin Elmer, NEL753001KT). Nuclei were stained with Hoechst 33342 (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both supernatant and lysate were moved to separate counting vials and mixed with 3 mL scintillation fluid (Ultima Gold #6013321, Perkin Elmer). 14C levels were measured in each sample using a Packard Liquid Scintillation Analyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was transferred to a tube and the protein-bound [α-32P]dCTP was quantified in a Beckman Coulter LS 6500 Liquid Scintillation Counter using OptiPhase HiSafe 3 (PerkinElmer) as solvent.
-
bioRxiv - Bioengineering 2021Quote: ... Mice were administered 3.3 mg D-Luciferin in the morning of day 3 and luminescence was recorded after 10 minutes by an In Vivo Imaging System (IVIS, Perkin Elmer) followed by i.v ...
-
bioRxiv - Neuroscience 2020Quote: ... was used as a secondary fluorophore for C1 probes (Gtpbp2, Slc7a1, Chac1) and TSA® Plus Cyanine 3 (PerkinElmer, 1:2,000) was used as a secondary fluorophore for C2 probes (Gtpbp1 ...
-
bioRxiv - Microbiology 2022Quote: ... The bound calcofluor was measured at excitation (λEx) 350 nm and emission (λEm) of 475 nm with VICTOR 3 1420 Multilabel Counter (PerkinElmer, USA).
-
bioRxiv - Microbiology 2022Quote: ... Animals were anaesthetized using an oxygen-filled induction chamber with 3% isoflurane and bioluminescence was measured using the in vivo imaging system IVIS (IVIS Spectrum Imaging System, Perkin Elmer). Mice were whole-body imaged in dorsal position and the signal intensity was obtained from luciferase expressed in T ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated at restrictive temperature (37°C) for 3 h and finally transfer to 384-well CellCarrier plates (PerkinElmer, 6007550) for imaging on an Opera QEHS high-content screening microscope (PerkinElmer) ...
-
Peripheral neuropathy linked mRNA export factor GANP reshapes gene regulation in human motor neuronsbioRxiv - Neuroscience 2021Quote: ... were hybridized for 2 h at 40°C followed by signal amplification and developing the HRP channel with TSA Plus fluorophore Cyanine 3 (1:1500) (NEL744001KT, Perkin Elmer) according to the manual ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Cell toxicity was assessed after 3 h of incubation by measuring fluorescence intensity using the Victor 3V spectrofluorometric multiwell plate reader (Perkin Elmer; excitation at 560 nm ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... the cultures added with 0.05% v/v DCPK and fluorescent emission for the next 3 hours followed as described in detail in (21) with a Gallios (Perkin Elmer) flow cytometer ...
-
bioRxiv - Neuroscience 2020Quote: ... Imaging was performed at 37°C and 3% CO2 using an Opera Phenix™ high-content confocal microscopy system (Perkin Elmer). Images were acquired at 40x magnification using a 425 nm laser for excitation of CFP and emissions detected at 435-515 nm (CFP ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were rinsed 3 times for 2 min in PBS-Tx and incubated in tyramide signal amplification (TSA) blocking reagent (PerkinElmer, FP1012) in PBS-Tx (TSA-block ...
-
bioRxiv - Microbiology 2020Quote: ... The dry filter paper was exposed to film for imaging before the individual dots on the filter paper were excised and scintillated with the addition of 3 ml scintillation fluid (Perkin Elmer). Radioactive counts were measured as scintillation counts per minute.
-
bioRxiv - Immunology 2022Quote: ... β-radioactivity was measured by liquid scintillation counting in a Beckman LS 6500 Multi-Purpose Scintillation Counter (scintillant Optiphase HiSafe 3; PerkinElmer, #1200.437). L-Alanine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... 12 pictures of at least 3 biological replicates were quantified using the Harmony high-content imaging and analysis software (Perkin Elmer).
-
bioRxiv - Microbiology 2023Quote: ... Oligonucleotide probes (listed in Supplementary file 3) for the different RNAs were labelled with 0.3 mCi of [γ-32P] ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: NMuMG cells expressing either EGFP-BIK-L61G or EGFP-PUMA4E were seeded (3,000 cells per well) in multiple wells (at least 3) of a 384-well microplate (CellCarrier-384 ultra, B128 SRI/160; Perkin Elmer) and allowed to grow for 24 h before staining with the nuclear dye DRAQ5 (5nM ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 pmol of DNA oligonucleotide (Eurofins MWG Operon, Germany) were 3’-end labelled with 3.3 pmol of α-32P-dATP (Perkin Elmer) using terminal deoxynucleotidyl transferase (TdT ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Immunology 2024Quote: Bacterial burden in MRSA /ux-infected mouse ears was monitored every 24 h for 3 or 7 consecutive days using an In Vivo Imaging System (IVIS) Spectrum (Perkin Elmer). Bacterial burden was quantified as the bioluminescence (radiance ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Cell Biology 2024Quote: ... After two washes of 5min in 1X RNAscope wash buffer slides were incubated with 1:1500 Cyanine 3 amplification reagent (PerkinElmer, #FP1170012UG), or 1:1000 Cyanine 5 amplification reagent (PerkinElmer ...
-
bioRxiv - Cell Biology 2021Quote: ... hand-picked human islets were dispersed in accutase for 10 min at 37°C and plated in 96-well plates (Perkin Elmer Inc., Waltham, MA) treated with Poly-D-Lysine Hydrobromide (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... an optimized set of 4 small interfering RNAs (siRNAs; SMARTPool) targeted against human Furin were purchased from Horizon Discoveries (Perkin Elmer, Lafayette, LA, USA) and transfections of HeLa cells were carried out using INTERFERin (PolyPlus ...
-
bioRxiv - Cancer Biology 2021Quote: ... For each PI3K isoform a 3 µL mixture (1:1) of enzyme/lipid substrate solution was added to a 384 well white assay plate (Perkin Elmer #6007299) containing 50 µL of test compound or DMSO only for untreated controls ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was washed in TTBS for 3 times and the signal was developed using Western Lightening Plus-ECL kit (PerkinElmer, Waltham, MA) and detected on HyBlot CL X-ray films (Denville).
-
bioRxiv - Molecular Biology 2021Quote: ... The plates were read at a wavelength of 460 nm using the VICTOR 3 V 1420 Multi-Label Microplate Reader (Perkin Elmer, USA). All reactions were carried out in triplicate using both antigenic peptides in separate experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... Imaging involving mNG-Bud8 (Figs. 3 & S2) was performed using a spinning disk confocal microscope (Ultra-VIEW VoX CSU-X1 system; Perkin Elmer-Cetus) equipped with a 100x /1.45 NA Plan-Apochromat Lambda oil immersion objective lens (Nikon) ...
-
bioRxiv - Cell Biology 2021Quote: Time-lapse or live-cell fluorescence microscopy was performed using a Zeiss Axiovert 200 M microscope (Plan Apochromat 1006, 1.4NA objective) with an Ultra-View RS-3 spinning disk confocal system (PerkinElmer Inc., United States) which equipped with a CSU21 confocal optical scanner ...
-
bioRxiv - Neuroscience 2021Quote: Live-cell imaging was performed at 37°C and with 3% CO2 using an Opera Phenix™ high content confocal microscopy system (Perkin Elmer). One hour prior to imaging ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of each phase were collected and measured in a 2480 automatic Gamma counter Wizard 2 3” (PerkinElmer, Waltham, MA, USA). LogD value were calculated using Excel by dividing measured values of octanol by water and logarithmize the result ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were then processed for visualization using the RNA-scope Multiplex Fluorescent reagent Kit v2 (Advanced Cell Diagnostics) and the Tyramide Signal Amplification (TSA™) Plus Cyanine 3 and TSA Plus Cyanine 5 systems (Perkin Elmer).