Labshake search
Citations for PerkinElmer :
251 - 300 of 1636 citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Multiplex stained slides were imaged using the Vectra Multispectral Imaging System version 2 (Perkin Elmer). Filter cubes used for multispectral imaging were DAPI (440–680 nm) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 pmol of DNA was incubated with 2 μL 5mCi [γ32-P]ATP (Perkin Elmer) and 4 μL T4 polynucleotide kinase (New England BioLabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... PRKACA inhibiting activity was screened using the EZ Reader 2 electrophoretic mobility shift platform (PerkinElmer). PRKACA enzyme (0.007 ng/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... The washed sepharose was then directly added to 2 mL Ultima GoldTM scintillation cocktail (PerkinElmer). Radioactivity was read by a Tri-Carb 2910TR scintillation counter (PerkinElmer) ...
-
bioRxiv - Neuroscience 2020Quote: ... Radioactivity of the filter paper was measured in a Microbeta 2 Scintillation Counter (Perkin Elmer) after addition of 3 mL Ultima-Gold Scintillation Fluid ...
-
bioRxiv - Physiology 2024Quote: ... Filters were dissolved in 2 ml liquid scintillation fluid (Filter Count, PerkinElmer, Waltham, MA, USA) and counted ...
-
bioRxiv - Microbiology 2023Quote: ... Infected cells were lysed 2 days after infection with a britelite plus (PerkinElmer, Cat#6066769), and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
-
bioRxiv - Microbiology 2020Quote: ... 100 μCi ml−1 [32P] phosphoric acid added to label newly synthesized RNA (Perkin Elmer #NEX053H). RNA was harvested in Trizol (Thermofisher #15596018 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Cell Biology 2021Quote: ... NEXTflex-6 barcoded adapters (PerkinElmer) were ligated using 1 μl Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Microbiology 2021Quote: ... Luciferase activity was read approximately 2 min later using a Wallac Victor3 plate reader (Perkin Elmer). 50% ADCC titers were estimated as previously described for virus neutralization assays (41) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 500 µM ATP (with 2 μCi of [γ-32P] ATP added per reaction; PerkinElmer BLU502Z250UC). Phosphorylated proteins were separated on 10% SDS-PAGE gels unless stated otherwise ...
-
bioRxiv - Physiology 2020Quote: ... Cells were incubated with 50 μM 2DG containing 0.25 μCi 3H-2-deoxyglucose (2DG, Perkin Elmer) for 5 min and washed three times with cold PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Isolated cardiac myocytes were incubated with 0.1 mM [1,3-3H]glycerol (2 μCi/dish, Perkin Elmer) or 0.1 μM [1-14C]linoleic acid (2 μCi/dish ...
-
bioRxiv - Cell Biology 2024Quote: ... The organs were harvested and imaged using the IVIS Lumina XRMS Series 2 instrument (PerkinElmer, USA) to assess the biodistribution of mannose ...
-
bioRxiv - Neuroscience 2023Quote: ... Isotope content was determined in 2 ml Ultima Gold™ XR scintillation liquid (6013119, Perkin Elmer) using the Tri-Carb 2900TR Liquid Scintillation Analyzer (Packard) ...
-
bioRxiv - Microbiology 2024Quote: ... The fluorescence intensity of 2 × 108 labeled cells was measured using an ARVO X3 apparatus (PerkinElmer) after 1 h of labeling ...
-
bioRxiv - Physiology 2024Quote: ... Cells were then incubated with 0.5 μCi [3H]-2-deoxy-D-Glucose (cat. no. NET328A001MC, PerkinElmer) and 0.1 μM 2-deoxy-D-Glucose (2DG ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Cat.#AL000F; PerkinElmer). For calibration ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Perkin Elmer, #AL000F). A 2-fold serial dilution of imiglucerase (Genzyme ...
-
bioRxiv - Physiology 2020Quote: ... [9,10-3H(N)]-oleic Acid (PerkinElmer) or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals ...
-
bioRxiv - Microbiology 2021Quote: ... and Tris buffer containing trace amount of 32P-labeled orthophosphoric acid (∼1.2 pmol and ∼1 µCi, PerkinElmer) and different concentrations of cold phosphate (NaH2PO4 ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Neuroscience 2020Quote: ... and TSA® Plus Cyanine 5 (1:1000, Perkin Elmer NEL745E001KT) evaluation kits ...
-
bioRxiv - Immunology 2020Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Systems Biology 2021Quote: ... columns 2-23 were used) of tissue-culture treated black CellCarrier-384 Ultra Microplates (Perkin Elmer 6057302) using a 12-channel electronic multichannel 200 μL pipettor [Sartorius] ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were loaded with 2 μCi/ml D-[2,3-3H]aspartate (Perkin Elmer, Waltham, MA, cat. #NET50100) in MEM +HIHS cell culture medium ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µL of cell culture medium or standard solution was added to an Optiplate-384 microplate (PerkinElmer). 21µL of 10X mixture including acceptor beads and biotinylated antibody was then added to the wells with culture media or standard solution ...
-
bioRxiv - Microbiology 2024Quote: ... and the luminescent signal was measured with an IVIS Lumina II (Perkin Elmer; 2-min exposure time). The luminescent signal was quantified with Living Image software (Perkin Elmer ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... the sections were incubated with diluted TSA plus Cy-3 (1:750, PerkinElmer, #NEL741001KT) for 30 minutes at 40°C in the oven ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with TSA plus Cyanine-3 reagent (1:2000, NEL760001KT, Perkin Elmer) for 10 to 15 min at RT in accordance with the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Plant Biology 2020Quote: ... were translated in WGE in a total volume of 12.5 µl with amino acids mixture or [35S]-methionine amino acid mixture (Ct= 3.06 μCi/0.14 MBq, 5.8 Ci/mmol, Perkin Elmer), 93 mM potassium acetate ...
-
bioRxiv - Pathology 2022Quote: Fatty acid uptake and incorporation into lipids as well as de novo lipogenesis were determined using [9,10-3H(N)]-oleic acid and [1,2-14C]-acetic acid (PerkinElmer), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... Of each sample three replicates and two formaldehyde-fixed (final conc. 1.85 %) adsorption blanks were spiked with [methyl-3H]-thymidine and L-[14C(U)]-leucine (Perkin Elmer) at saturating concentrations of 20 nM and 150 nM ...
-
bioRxiv - Genomics 2023Quote: ... at a total concentration equivalent to 0.8 μM nucleosomes and 5.0 μM 14C-SAM (S- [methyl-14C]-adenosyl-l-methionine (PerkinElmer, no. NEC363050UC)) ...
-
bioRxiv - Physiology 2021Quote: ... 4.5µCi 3H-oleic acid (NET289001MC, Perkin Elmer), was dried down under N2 then resuspended in PBS and combined 1:1 with 40% fatty-acid free bovine serum albumin to a final volume of 200µl ...
-
bioRxiv - Biophysics 2023Quote: ... Radioactive amino acids are purchased from PerkinElmer. Other reagents are from Millipore Sigma if not specified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... on a Chemagic360 nucleic acid extractor (PerkinElmer) with a 96-well rod head after samples were homogenized using a steel ball in lysis buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... [U-14C]palmitic acid (Perkin Elmer, NEC534050UC), 100 µM cold palmitic acid (Sigma-Aldrich ...