Labshake search
Citations for PerkinElmer :
201 - 250 of 1426 citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Pathology 2023Quote: 14C-labeled palmitic acid (C16) and 14C-octanoic acid (C8) were from PerkinElmer while 14C-DC12 and 14C-lignoceric acid (C24 ...
-
bioRxiv - Plant Biology 2020Quote: ... For all assays 1 μCi [3 H]-D-glucose (PerkinElmer, USA) was used as the radioactive tracer ...
-
bioRxiv - Genetics 2022Quote: ... treated with the TSA Plus Cyanine 3 System 1% (PerkinElmer, USA) for 5 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and 7 μCi [35S]-Methionine/cysteine (PerkinElmer; NEG072007MC) and labelled for 2 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1: 5000 followed by incubation with 1:50 to 1: 100 TSA plus Cyanine 3 solution (Perkin Elmer). To detect two genes at a time ...
-
bioRxiv - Cell Biology 2020Quote: ... and all qualitative imaging of Kif19 plasmids were conducted on a 4-D spinning-disk confocal microscope (PerkinElmer) with 60x (1.4 NA ...
-
bioRxiv - Molecular Biology 2019Quote: ... exponentially growing 4×105 HEK293T cells were cultured 90 min with 200 µCi/ml [S35]-methionine (Perkin Elmer) in methionine and cysteine-free DMEM containing 100 µg/ml of emetine ...
-
bioRxiv - Neuroscience 2020Quote: ... TR-FRET measurements were routinely performed following overnight incubation at 4°C using an EnVision Reader (Perkin Elmer). Values were collected as the background subtracted ratio between fluorescence emission at 665 nm and 615 nm where the background signal corresponds to the ratio (665/615 ...
-
bioRxiv - Microbiology 2021Quote: KN99α was grown as described above in MM supplemented with 2 μCi/ml 3H-NE and 1.0 mM unlabeled NE or a mixture of 1.0 mM unlabeled NE and DA or with 4 μCi/mL (0.0001 mM) Dihydroxyphenylethylamine 3,4-[Ring-2,5,6-3H] (3H-DA, Perkin Elmer NET673250UC) and 1.0 mM unlabeled DA or 1.0 mM unlabeled NE and DA for 10 d at 30°C ...
-
bioRxiv - Immunology 2022Quote: ... Prior to the immunization all mice were anesthetized by isoflurane inhalation with RAS-4 Rodent Anesthesia System (PerkinElmer). Mice were euthanized on day 28 for terminal blood collection and spleens were harvested for cellular assays ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 4 µl of suspension was carefully distributed in the centre of an optical-bottom 96-well (PerkinElmer) for immunofluorescence experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Live imaging was done 4-8h later using a spinning disk confocal microscope (Perkin Elmer Ultra View ERS) equipped with a heating chamber (37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... filters were placed into scintillation vials with 4 mL Emulsifier-safe liquid scintillation fluid (Perkin Elmer, Waltham, MA) and analyzed using a liquid scintillation counter ...
-
bioRxiv - Cell Biology 2023Quote: ... the rabbit reticulocyte lysate master mix was supplemented with EasyTag L-35-Methionine (4% final reaction volume; PerkinElmer). Canine rough pancreatic microsomes (cRMs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were fixed in 4% PFA and imaged with the Opera Phenix High Content Screening System (Perkin Elmer), acquiring at least 10 images per well ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1:1000 Cyanine 5 amplification reagent (PerkinElmer, #FP117024UG) in TSA buffer (ACD ...
-
bioRxiv - Molecular Biology 2021Quote: ... The medium was removed and 125I-GLP-1(7-36)NH2 (60 pM) or 125I-GCG (40 pM) (PerkinElmer) and increasing concentrations unlabeled tirzepatide or peptide 20 were added for overnight incubation at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then separated on a HayeSep column (7’ HayeSep N 1/8’’ Sf; PerkinElmer Inc., Waltham, USA), followed by molecular sieve (9’ Molecular Sieve 13x 1/8’’ Sf ...
-
bioRxiv - Biochemistry 2023Quote: ... [14C]-palmitic acid (Perkin Elmer) was added to a final activity concentration of 0.2 μCi/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μL/well) was captured overnight at 4°C onto high-protein-binding ELISA plates (Spectraplate 96HB, Perkin Elmer). Plates were washed in PBS/Tween (0.05% v/v ...
-
bioRxiv - Microbiology 2022Quote: ... one ml of culture was labelled for 4 min at 30 °C using 30 μCi γ-[32P]ATP (PerkinElmer). Samples were incubated with 6% sucrose ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 μL/well of cell culture supernatant was taken out and dispensed into OptiPlate-384 microplates (PerkinElmer, cat #: 6007290) that was pre-filled by 12 μL/well PBS by an EL406 ...
-
bioRxiv - Immunology 2023Quote: ... uptake inhibition and degradation were determined in M[0] and M[IL-4] using 3H-choline chloride (Perkin Elmer) as previously described [4].
-
bioRxiv - Cell Biology 2022Quote: Candidate small RNA sequences were identified from raw sequence data using cutadapt (ver. 2.8)21 with parameters “-u -4 -a A(10)” as recommended by PerkinElmer NextFlex Combo-Seq kit ...
-
bioRxiv - Microbiology 2020Quote: ... 100 μCi ml−1 [32P] phosphoric acid added to label newly synthesized RNA (Perkin Elmer #NEX053H). RNA was harvested in Trizol (Thermofisher #15596018 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 293FT (1.5 × 104) cells expressing DSP1–7 (293FT/DSP1–7) were plated in 96-well plates (Perkin Elmer Life Sciences, Waltham, MA, USA) with DMEM supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Emission signal was collected using a liquid crystal tunable filter (LCTF) (VariSpec VIS-7-35, PerkinElmer, Inc. Waltham, MA, USA, 7 nm bandwidth) programmed to collect at 515 nm and a high-resolution dual-modal charge-coupled device (CCD ...
-
bioRxiv - Biophysics 2021Quote: ... Cell fixation was performed 24h after transfection using 4% formaldehyde and cellular imaging was performed using an Operetta CLS (PerkinElmer). Three individual plate preparations were used as independent experiments for statistical significance (n=3) ...
-
bioRxiv - Biophysics 2022Quote: ... incubated for 4 h at 37°C and fluorescent signal intensity was quantified using the EnSpire Multimode Plate Reader (PerkinElmer) at excitation and emission wavelengths of 540 and 612 nm respectively.
-
bioRxiv - Molecular Biology 2020Quote: ... The protein pellet was then re-suspended in PBS and incubated in 4 mL of scintillation fluid (Insta-Gel Plus, PerkinElmer) for 24 h (to homogenize the samples ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 nM of hNatD was mixed with 2 μM of radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences), 20 μM of the peptide ...
-
bioRxiv - Biophysics 2020Quote: ... separated free and bound radioligand and the radioactivity on each filter determined by the addition of 4 mL of Ultima Gold XR liquid scintillant (PerkinElmer), overnight incubation at room temperature and count using a Beckman Coulter LS 6500 Multi-purpose scintillation counter (Beckman Coulter Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... To quantify α1-3;5GABAAR79 sections were incubated for 60 minutes at 4°C in 1nM [3H]flumazenil (Perkin Elmer, NET757001MC), or in 1nM [3H]flumazenil with 10 µM flunitrazepam (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were cultured in α-MEM containing media containing 2μM Glutamine and 4 mCi/mL L-[3,4-3H(N)]-Glutamine (PerkinElmer, NET551250UC). GLS activity was terminated by washing cells with ice cold HBSS for three times followed by scaping cells with 1 mL ice cold milliQ water ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Aerrane (Isoflurane, Baxter) inhalation was performed for anesthesia using the RAS-4 Rodent Anesthesia System (Perkin Elmer, Waltham, MA, USA) for experiments with IVIS Spectrum CT living imaging system (Perkin Elmer ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were washed with PBS and then stored in PBS at 4°C until imaged in the Opera Phenix (PerkinElmer) at 40x magnification and images analysed using a Harmony software to assess protein expression and morphology (see supplementary).
-
bioRxiv - Pathology 2023Quote: ... double immunohistochemistry for paraffin sections (8 μm) was conducted by using the Opal 4 color manual immunohistochemistry (IHC) kit (NEL810001KT, PerkinElmer). The signal of p-MLC2 was amplified by the Opal 4 color manual IHC kit (NEL810001KT ...
-
bioRxiv - Bioengineering 2024Quote: ... The plates were incubated for 4 h at 37°C and then the supernatant was removed and incubated with scintillation fluid (PerkinElmer) overnight at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Perkin Elmer, #AL000F). A 2-fold serial dilution of imiglucerase (Genzyme ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Cat.#AL000F; PerkinElmer). For calibration ...
-
bioRxiv - Physiology 2020Quote: ... [9,10-3H(N)]-oleic Acid (PerkinElmer) or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals ...
-
bioRxiv - Physiology 2024Quote: ... [14C(U)] palmitic acid (Perkin Elmer), and [14C] triolein (TG) ...
-
bioRxiv - Microbiology 2021Quote: ... and Tris buffer containing trace amount of 32P-labeled orthophosphoric acid (∼1.2 pmol and ∼1 µCi, PerkinElmer) and different concentrations of cold phosphate (NaH2PO4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 7 mCi of γ-32P-ATP (PerkinElmer, 3000 Ci/mmol), and either DMSO or 2 μM of the Cdk4/6-inhibitor Palbociclib (Selleckchem ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.