Labshake search
Citations for PerkinElmer :
2201 - 2250 of 2856 citations for 11 Ketotestosterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... culture plates were incubated for 3 days after which they were imaged with an Operetta CLS high-content analysis system (Perkin Elmer, LIVE configuration) with the incubation chamber set to 37 °C and 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: N/TERT cells or human primary keratinocytes of various genotypes were seeded at a cell density of 10,000 cells/well in a black 96-well plate (PerkinElmer, CellCarrier-96 Ultra, #6055300) or a cell density of 80,000 cells/well in black 24-well plates (Cellvis ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell plates were immediately started for live cell imaging on an automated spinning-disk confocal high-content imaging system (Perkin Elmer, Opera Phenix) using a 40X water immersion objective lens under 5% CO2 and 37 °C condition ...
-
bioRxiv - Plant Biology 2023Quote: ... The absorbance of 100 µl of the reaction solutions at 820 nm was measured using a ARVOX3 plate reader (PerkinElmer, Waltham, MA, USA) or a BioTek Synergy H1 (BioTek Instruments Inc. ...
-
bioRxiv - Immunology 2023Quote: ... luciferase activity was quantified by the addition of Steadylite Plus chemiluminescence substrate and analysis on a Perkin Elmer EnSight multimode plate reader (Perkin Elmer, Beaconsfield, UK). Antibody titre was then estimated by interpolating the point at which infectivity had been reduced to 50% of the value for the no serum control samples.
-
bioRxiv - Cancer Biology 2023Quote: ... cell fluorescence was detected under the KEYENCE BZ-X800 fluorescence microscope and measured by the Multilabel Plate Reader ARVO X5 (PerkinElmer, Waltham, MA, USA) at Em 440 nm and 535 nm in response to Ex at 340 and 380 nm ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were seeded at 25000 cells per well in culture medium into white bottom opaque 96 well plates (Perkin Elmer cat no. 5680). Plates were incubated at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Colorimetric or fluorimetric quantifications of the respective readouts were done in a multiwell plate reader (Wallac Victor 3 V, PerkinElmer, Waltham, MA, USA) and conducted in white 96-well plates.
-
bioRxiv - Microbiology 2024Quote: ... Fluorescence was measured at 485 nm excitation and 528 nm emission in a VICTOR® Nivo™ plate reader (Perkin Elmer, Waltham, USA) and the IC50s values were then calculated using Prism 7 (GraphPad ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... diluted 20-fold in 1X HBSS for 20 minutes at room temperature and total luminescence read using the Microbeta2 plate reader (Perkin Elmer, Waltham, MA) detecting total light counts in one second in each well ...
-
bioRxiv - Immunology 2020Quote: ... Staining of neutrophils (specifically myeloperoxidase activity) in LWT wild-type larvae was completed using TSA staining kit (Cy5-TSA Cyanine Kit, PerkinElmer, NEL705A001KT). Fish were incubated in a 1:100 ratio of Cy5-TSA:amplification diluent at 28°C for 10 minutes in the dark ...
-
bioRxiv - Cancer Biology 2021Quote: In vitro methyltransferase assays were performed using 30 ul reaction buffer (50 mM Tris-HCl pH 7.8, 50 mM KCl, 5 mM MgCl2) with 1 ul 3H-AdoMet (Perkin Elmer, specifific activity = 55-85 Ci/mMole,0.55 μCi/ul ...
-
bioRxiv - Cell Biology 2020Quote: ... and labeled for 5 min with with 1 μL per OD of cells of EXPRESS 35S Protein Labeling Mix (PerkinElmer) for 5 or 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... the plates containing infected macrophages were incubated at 37°C with 5% CO2 for 18 h in an Operetta High-Content Imaging System (PerkinElmer). During this 18 h incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were incubated for 5 minutes at 37°C with 55µCi/well of 35S-L-methionine and 35S-L-cysteine Promix (Perkin Elmer) in a minimal volume of culture medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cell motility was acquired using temperature (37°C) and CO2 (5%) controlled Operetta CLS High-Content Analysis System (PerkinElmer, HH16000000) (non-confocal ...
-
bioRxiv - Molecular Biology 2019Quote: ... was first deprotected and phenol-chloroform extracted and then 5’ end radiolabeled with [γ-32P] ATP (PerkinElmer, 6000 Ci/mmol) using T4 PNK (New England Biolab or Thermofisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cells were then incubated with 5 nM [3H]-E2 (specific activity 87.6 Ci/mmol; PerkinElmer Life Science, Waltham, MA) in the presence of increasing concentrations of 2’ ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Spectra were analysed using OPUS 6.5 software (Bruker) and compared with RMIT University’s spectral library of organic compounds generated using Spectrum 10 software (Perkin Elmer). Fingerprint spectra shown in Figure 4D were prepared using GraphPad Prism.
-
bioRxiv - Neuroscience 2021Quote: ... plates were centrifuged once more under same conditions mentioned above and 5 µL of each FRET antibody pair was added (2.5 nM final concentration for donor and 5 nM for acceptor, diluted in 1x Lance buffer, (Perkin Elmer)) ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Microbiology 2022Quote: ... was phosphorylated in vitro with His-MBP-PknBMtb at 0.015 μg/μl for 30 minutes at room temperature with 0.15μCi/μl ATP [γ-32P] (5×10-8 μmol) (3000Ci/mmol, 10mCi/ml, PerkinElmer BLU002A250UC) and 2mM MnCl2 in buffer (50mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... Nifene or nicotine respectively for 5 min followed by addition of 2.5 nM [125I]-epibatidine ([125I]Epb) (2200 Ci/mmol; Perkin Elmer) and incubation for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were grown for imaging using standard conditions and imaged in low fluorescence medium containing 5 µg/ml Dextran Alexa Fluor 647 on an Opera Phenix (PerkinElmer) automated system as described above.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.05□μl of 5□mM stock compounds in DMSO were dispensed into assay microplates with a Janus 384 MDT NanoHead (PerkinElmer). Final concentration of the screening compounds in the assay was 16LμM ...
-
bioRxiv - Neuroscience 2023Quote: ... Live cell imaging was performed at 37°C in 5% CO2 for 24 hours using the Opera Phenix High Content Screening System (PerkinElmer). Acquired images were analyzed by using the Harmony software (PerkinElmer).
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed with the DNA absorption solution (for one sample: 50 uL 5 M NaCl, 15 ul magnetic beads (GMG-252-A-100mL – PerkinElmer), 250 uL 7.8 M guanidium chloride ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Cell Biology 2024Quote: ... Tem1 (3.3 µM final concentration) was mixed with GTP (33 µM final) supplemented with 5 µCi [α-32P]-GTP (PerkinElmer) in the reaction buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Filters with the bound radioligand were transferred to vials containing 5 mL of Ultima Gold cocktail (PerkinElmer, Boston, MA, USA) and measured with a Packard Tri-Carb 2200CA liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Microtubes were then centrifuged at 1000g for 5 min and radiolabeled lipids were counted in the upper phase with a Tri-Carb 4910TR liquid scintillation counter (PerkinElmer). Results were normalized to total protein content and expressed in comparison to control cells.