Labshake search
Citations for PerkinElmer :
2101 - 2150 of 2689 citations for Corticosterone ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were grown for imaging using standard conditions and imaged in low fluorescence medium containing 5 µg/ml Dextran Alexa Fluor 647 on an Opera Phenix (PerkinElmer) automated system as described above.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.05□μl of 5□mM stock compounds in DMSO were dispensed into assay microplates with a Janus 384 MDT NanoHead (PerkinElmer). Final concentration of the screening compounds in the assay was 16LμM ...
-
bioRxiv - Neuroscience 2023Quote: ... Live cell imaging was performed at 37°C in 5% CO2 for 24 hours using the Opera Phenix High Content Screening System (PerkinElmer). Acquired images were analyzed by using the Harmony software (PerkinElmer).
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed with the DNA absorption solution (for one sample: 50 uL 5 M NaCl, 15 ul magnetic beads (GMG-252-A-100mL – PerkinElmer), 250 uL 7.8 M guanidium chloride ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Cell Biology 2021Quote: ... hand-picked human islets were dispersed in accutase for 10 min at 37°C and plated in 96-well plates (Perkin Elmer Inc., Waltham, MA) treated with Poly-D-Lysine Hydrobromide (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: N-T TERT cells of various genotypes were seeded at a cell density of 10000 cells/well in a black 96 well plate (PerkinElmer, CellCarrier-96 Ultra, #6055300). The next day cells were treated with chemicals and stained with 1μg/ml dilution of propidium iodide (PI ...
-
bioRxiv - Synthetic Biology 2019Quote: Transient transfections had approximately 75,000 in 500 μL of complete supplemented DMEM media added to each well of a VisiPlate-24 well black plate (PerkinElmer, catalog number: 1450-605) and were first grown for 24 hours ...
-
bioRxiv - Genetics 2019Quote: ... The increased fluorescence was measured (using an excitation between 530-560 nm and an emission at 590 nm) using an EnVision® multimode plate reader (Perkin Elmer, Llantrisant, UK). The biological activity was calculated for each protein from proliferation curves using GraphPad Prism version 6.0.
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent emission was read at 665 nm and 620 nm in an EnVision® Xcite Multilabel Plate Reader (PerkinElmer, Waltham, MA, USA). IP1 content was calculated based on a standard curve covering concentrations from 2.7–11,000 nM according to the IP-ONE kit protocol.
-
bioRxiv - Neuroscience 2019Quote: ... Fluorescence emission intensity of GCaMP6s was recorded at 515 nm upon excitation at 488 nm on an EnSpire® Multimode Plate Reader (PerkinElmer, Boston, MO, USA) for 330 s every 5 s and 100 flashes per well ...
-
bioRxiv - Biochemistry 2021Quote: ... Plates were incubated at room temperature for 2 h before measurement of the fluorescence using an EnVision Multimode Plate (Reader PerkinElmer Life and Analytical Sciences). All values were converted to cAMP concentration using cAMP standard curve performed parallel and data were subsequently normalized to the response of 100 μM forskolin in each cell line ...
-
bioRxiv - Biochemistry 2021Quote: ... Ub-AMC cleavage was monitored by measuring fluorescence in real time for at least 30 min at 365 nm excitation and 460 nm emission with an EnVision plate reader (Perkin Elmer, ICCB Facility, HMS). The initial kinetics observed within the linear range was used for plotting ...
-
bioRxiv - Developmental Biology 2022Quote: ... 45 μL of the resuspension was distributed to six wells of a 96-well OptiPlate black-white plate (Perkin Elmer Life Sciences, Waltham, MA). Cells were then incubated for 10 mins with 10 μL coelenterazine-h (final concentration 5 μM ...
-
bioRxiv - Microbiology 2022Quote: ... and 200 μl of parasites were applied to each well of HFF cells grown in 96-well plates with transparent bottoms (Perkin Elmer cat. no. 6055300). Plates were centrifuged at 290 g for 5 minutes ...
-
The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfallsbioRxiv - Neuroscience 2023Quote: Global CB1R signalling was determined by label-free technology as previously described (Costas-Insua et al, 2021; Maroto et al, 2023) by using an EnSpire® Multimode Plate Reader (PerkinElmer, Waltham, MA, USA). Briefly ...
-
bioRxiv - Genomics 2023Quote: ... was measured in triplicate and averaged at 405 nm for 45-60 minutes at 25°C on a Wallac Victor 2 1420 Multilabel Counter Plate Reader (Perkin Elmer, Waltham, MA, USA). Citrate synthase activity was standardized against the protein concentration of each sample using the Bovine Serum Albumin Assay (500-0201 ...
-
bioRxiv - Immunology 2023Quote: ... A chemiluminescence assay was conducted for continuous measurement of chemiluminescence counts per second (cps) at 37°C in an Envision multimode plate reader (PerkinElmer Life Sciences, Waltham, MA), recording measurements at 1 min intervals.
-
The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019Quote: ... with the Opal seven-color IHC Kit (NEL797B001KT; PerkinElmer) containing the fluorophores ...
-
bioRxiv - Genomics 2020Quote: A NEXTflex® Rapid Directional qRNA-Seq Kit (PerkinElmer) was used to sequence the whole ASFV transcriptome via a conventional short-read approach ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted using the Chemagen kit (Perkin Elmer), in batches by cohort ...
-
bioRxiv - Biochemistry 2021Quote: ... cAMP signal was detected by LANCE cAMP kit (PerkinElmer) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tyramide biotin amplification (TSA Plus Biotin Kit, Perkin Elmer) was performed for 10 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... The TSA-Kit secondary antibody system (Perkin Elmer, NEL763E001KT) was utilized with Lef1 immunostaining.
-
bioRxiv - Genomics 2020Quote: ... The NEXTflex® Rapid Directional qRNA-Seq Kit (PerkinElmer) was used for library preparation from the rRNA-depleted sample ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... ATPLite Luminescence Assay kit was purchased from PerkinElmer (6016949). Cell Staining Buffer (420201 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... ATPLite Luminescence Assay kit was purchased from PerkinElmer (6016949). Cell Staining Buffer (420201 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the BigDye Terminator cycle sequencing kit (Perkin Elmer, Applied Biosystems Division ...
-
bioRxiv - Neuroscience 2021Quote: ... (TSA Fluorescence Kit, Catalog # NEL760001KT; PerkinElmer, Inc., MA, USA) was added for 30 min at 40°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and developed using the ECL detection kit (PerkinElmer, NEL105001EA).
-
bioRxiv - Genomics 2022Quote: ... and TSA-biotin (TSA Plus Biotin Kit, Perkin Elmer) and streptavidin-conjugated Atto 425 (Sigma Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... NEXTFLEX® Small RNA-seq kit v3 (Perkin Elmer) was used according to the manufacturer’s instructions to prepare the small RNA libraries ...
-
bioRxiv - Neuroscience 2022Quote: ... and revealed with the TSA kit (PerkinElmer, cat. #NEL704A001KT) using Cy3 tyramide at 1:100 ...
-
bioRxiv - Plant Biology 2023Quote: ... and LabChip GX-Touch (DNA High Sensitivity kit, PerkinElmer), respectively ...