Labshake search
Citations for PerkinElmer :
151 - 200 of 1631 citations for 7 3S 5S 3 Amino 5 methyl 1 piperidinyl 1 cyclopropyl 1 4 dihydro 8 methoxy 4 oxo 3 quinolinecarboxylic acid with 2 hydroxybutanedioic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
SPNS1 is required for the transport of lysosphingolipids and lysoglycerophospholipids from lysosomesbioRxiv - Biochemistry 2022Quote: ... and lower phase (containing [3-3H]-sphingosine, [3-3H]-ceramides, [3-3H]-SM) were quantified by a scintillation counter (Perkin Elmer Tri-Carb Liquid Scintillation Analyzer).
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Biochemistry 2023Quote: ... to S-adenosyl-L-[methyl-3H]-methionine ([methyl-3H]-SAM) (PerkinElmer)] ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μL γ32P-dATP (Perkin Elmer), and 5 μL H2O for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... 3 pM GTP α-32P (PerkinElmer), 10 Units of VCE and incubated 30 min at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.5 ml Optiphase HISAFE 3 (PerkinElmer) was incubated with the filter overnight before liquid scintillation counting with MicroBeta JET (PerkinElmer) ...
-
bioRxiv - Genomics 2022Quote: ... and TSA Plus Cyanine 3 (PerkinElmer). After the last washing step ...
-
bioRxiv - Immunology 2021Quote: ... with the last 8 hours in the presence of [3H] thymidine (1 mCi/well, NET027001MC; PerkinElmer). Incorporated [3H] thymidine was counted by a BetaPlate scintillation counter (Wallac ...
-
bioRxiv - Physiology 2019Quote: ... A bolus injection of [1-14C]-2-deoxyglucose ([14C]2DG; PerkinElmer) (10 µCi ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 10% BSA and 3 µl [35S] EasyTag Express protein labelling mix (7 mCi, 259 MBq, 1175 Ci/mmol in 632 ml; Perkin Elmer, Espoo, Finland). After 2 h of incubation at 37 °C cells were washed twice with PBS ...
-
bioRxiv - Pathology 2023Quote: ... double immunohistochemistry for paraffin sections (8 μm) was conducted by using the Opal 4 color manual immunohistochemistry (IHC) kit (NEL810001KT, PerkinElmer). The signal of p-MLC2 was amplified by the Opal 4 color manual IHC kit (NEL810001KT ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μM mononucleosomes and 5.0 μM S-[methyl-14C]-adenosyl-l-methionine (PerkinElmer, #NEC363050UC) in the presence or absence of stimulatory or control peptides in concentrations as indicated in the text ...
-
bioRxiv - Genomics 2020Quote: ... and labeled with TSA Cyanine 5 (Perkin Elmer #NEL705A001KT, 1:1000 dilution). Next ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μM cold ATP and 5 μCi [γ32P] - ATP (Perkin Elmer, USA). The reaction was incubated for 30 minutes at 30°C and stopped by adding Laemmli buffer and boiling at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µCi of [1-14C] acetate (NEC084H001MC, Perkin Elmer, Waltham, MA, USA) per mL was added and the cells were cultured for four more hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... on a LabChip GX Touch HT Nucleic Acid Analyzer (CLS137031, PerkinElmer). TruSeq Stranded mRNA Library Prep kit (20020594 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µCi of [1-14C]-palmitate (2.22 GBq mmol-1, Perkin Elmer) was added to 10 ml culture medium of exponentially or stationary phase-grown bacteria and further incubated for 1.5 h at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Systems Biology 2023Quote: ... Finally 100 μl sample was added to scint vials containing 3 mls scintillant (OptiPhase HiSafe 3, Perkin Elmer). β-radioactivity was measured with Tri-Carb 4910TR liquid scintillation counter.
-
bioRxiv - Systems Biology 2020Quote: ... Cy3-TSA (3 min; Perkin Elmer NEL744001KT), Cy5-TSA (7 min ...
-
bioRxiv - Microbiology 2021Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Immunology 2021Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μL 35S-labeled methionine (PerkinElmer NEG709A500UC), 2.5 μL recombinant protein (~450ng ...
-
bioRxiv - Microbiology 2022Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Molecular Biology 2021Quote: ... The medium was removed and 125I-GLP-1(7-36)NH2 (60 pM) or 125I-GCG (40 pM) (PerkinElmer) and increasing concentrations unlabeled tirzepatide or peptide 20 were added for overnight incubation at 4°C ...
-
bioRxiv - Biophysics 2023Quote: ... 14C-malic acid was purchased either from Perkin Elmer (Waltham, MA, USA) (#2625350 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and quantified with a LabChip GX Touch HT Nucleic Acid Analyzer (PerkinElmer) to ensure that sufficient cDNA amounts were generated for the library construction ...
-
bioRxiv - Plant Biology 2020Quote: ... detection limit 5 ng.L−1) and K+ content by ICP-AES (-Atomic Emission Spectrometry, OPTIMA 8300, Perkin Elmer, quantification limit 10 μg.L−1).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 4 μL/well of ATPLite (PerkinElmer) was added to assay plates and incubated for 15 min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 μL/well of ATPLite (PerkinElmer) was dispensed ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl/well of ATPLite (PerkinElmer) was added to assay plates and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: cAMP detection was performed in 1/2-area white 96-well plates (PerkinElmer), using the LANCE cAMP Kit (PerkinElmer ...
-
bioRxiv - Cell Biology 2019Quote: GBM2 cells were plated at 2000 cells/well and exposed to Prestwick compounds (3 µM; Table 6) for 3 days in 384-well optical bottom assay plates (PerkinElmer). Cells were then fixed and stained with rabbit polyclonal anti-H3K27ac and mouse monoclonal anti-H3K27me3 antibodies followed by AlexaFluor-488- or AlexaFluor-555-conjugated secondary antibodies ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Immunology 2024Quote: ... Tumor progression was subsequently monitored every 2-3 days using caliper measurement and the IVIS Spectrum imaging system (PerkinElmer) to measure bioluminescent signal after intraperitoneal administration of 0.15 mg of luciferin substrate per gram of body weight (PerkinElmer 122799) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-D reconstruction was performed with Volocity (PerkinElmer).
-
bioRxiv - Cancer Biology 2019Quote: ... and imaged 1 to 5 min with an IVIS50 system (Perkin Elmer, Courtaboeuf, France). Bioluminescence intensity is expressed as photons per second (p/s).
-
bioRxiv - Developmental Biology 2020Quote: ... Staining was visualized with DAB or TSA Plus Cyanine 5 (NEL745001KT, PerkinElmer; 1:750). Combined ISH and immunofluorescence (IF)/immunohistochemistry (IHC ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were collected on filters with a cell harvester (PerkinElmer Life Sciences). After addition of MicroScint O (PerkinElmer Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... which contains inhibitors and 1 μCi D-[2-3H]-glucose (23.4 Ci/mmol, PerkinElmer). After 30 s’ reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μL 10X T4 PNK buffer and 2 μL [γ-32P] ATP (Perkin Elmer). The volume was adjusted to 10 μL with water and incubated at 37°C for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Molecular Biology 2020Quote: 1 μl ml-1 of 0.1 mCi ml-1 14C glucose (PerkinElmer, Cat# NEC042V250UC, Waltham, MA, USA) was added to differentiation medium 48 h before the end of the experiments ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM MgCl2 and 1 mM DTT) supplemented with 0.76 μM radioactively labelled AdoMet (PerkinElmer) for 4 h at 37 °C or overnight at 25 °C ...