Labshake search
Citations for PerkinElmer :
1751 - 1800 of 3238 citations for Estrone 3 Glucuronide E1G ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... was performed according to the manufacturer’s instructions and luminescent signals were acquired with an EnVision plate reader (Perkin Elmer).
-
bioRxiv - Biophysics 2023Quote: ... Fluorescence readings at excitation 680 nm and emission 570 nm were measured on an EnVision 2105 plate reader (PerkinElmer). EC50 values were calculated from nonlinear regression curve fits (excluding any data points above the hook effect concentration ...
-
bioRxiv - Neuroscience 2023Quote: OPCs were seeded at a density of 12,500 cells per well in CellCarrier Ultra 384-well plates (PerkinElmer, 6057500), pre-coated with poly-D-lysine and laminin (Sigma ...
-
bioRxiv - Systems Biology 2023Quote: ... and subsequently 1500-2000 cells were plated onto Matrigel-coated 384-well plates (PhenoPlate 384-well, Perkin Elmer, #6057308) with mTeSR Plus supplemented with 10uM Y-27632 (Peprotech ...
-
bioRxiv - Neuroscience 2023Quote: ... Emitted light corresponding to the number of ATPs was measured in a Victor® XLight Multimode Plate Reader (PerkinElmer). For each sample ...
-
Ozone mediates tumor-selective cell death caused by air plasma-activated medium independently of NOxbioRxiv - Cancer Biology 2023Quote: ... Absorbances at 450 nm were measured by a Nivo 3F Multimode Plate Reader (PerkinElmer Japan Company, Ltd., Yokohama, Japan).
-
bioRxiv - Developmental Biology 2023Quote: Following immunostaining, 96-well plates (Dutscher Dominique, 655090) were imaged on an Opera Phenix high-content microscope (Perkin Elmer) using a 20x or 40x objective ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM glutamine and 1x penicillin/streptomycin antibiotic mix at 15,000 cells per well in 96 well imaging plates (catalogue number 6005182; PerkinElmer) 24 h before infection in the same medium with the various SARS-CoV-2 strains ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plates were imaged with an Opera Phenix automated spinning-disk confocal microscope at 20X magnification (Perkin Elmer, USA). Single cells were segmented based on nuclear DAPI staining with CellProfiler v2.2.0 Software ...
-
bioRxiv - Systems Biology 2023Quote: ... about 10,000 A549 and MDCK cells were seeded in 96 well plates (CellCarrier-96 Ultra Microplates Catalog No.: 6055300, PerkinElmer) and were grown at 37 °C in humidified 5% CO2 for 24hrs ...
-
bioRxiv - Microbiology 2023Quote: ... Viruses (equivalent MOI of 50) were added to cells in 96 well imaging plates (PerkinElmer, CellCarrier 96 ultra, 6055302) at 37°C for 60 min ...
-
bioRxiv - Microbiology 2023Quote: ... subtilis DK1042 Phy-mKate2 were mixed in equal volumes in 96-well imaging microtiter plates (PerkinElmer, Waltham, MA, USA) in TSB or 0.1× LBGM (Fig ...
-
bioRxiv - Immunology 2023Quote: ... 2x104 Vero E6-TMPRSS2 cells per well were seeded in 96-well luminometer-compatible tissue culture plates (Perkin Elmer) and incubated overnight ...
-
bioRxiv - Biophysics 2022Quote: ... plates were harvested by vacuum filtration onto 0.3% (v/v) polyethyleneimine pre-soaked 96- well filter mats (Perkin Elmer) using a 96-well Filtermate harvester ...
-
bioRxiv - Cell Biology 2023Quote: ... 0,5 µl were transferred from the compound plate onto the cells with the Sciclone G3 Liquid Handling Workstation (PerkinElmer). Before addition of compounds ...
-
bioRxiv - Cell Biology 2023Quote: ... INS-1E cells were seeded at 20,000 cells per well in a CellCarrier Ultra 96-well plate (Perkin Elmer). Cells were incubated for 24 h ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence signals were measured at 460 nm with excitation at 360 nm on an Envision Multimode Plate Reader (PerkinElmer). An identical reaction containing boiled TgTR was used as a negative control ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence signals were measured at 460 nm with excitation at 360 nm on an Envision Multimode Plate Reader (PerkinElmer). Measurements were taken over a period of 15–20 min and background NADH consumption was subtracted at each timepoint ...
-
bioRxiv - Immunology 2022Quote: ... Plates were finally washed 2x with PBS-T and 1x with PBS and incubated with TMB substrate (Perkin Elmer) until the reaction was quenched HCl ...
-
bioRxiv - Microbiology 2023Quote: ... 100uL of media was removed from the plate and incubated with 100 uL Britelite Plus reagent (PerkinElmer, Waltham, MA) for 2 minutes followed by mixing and transferring to a black 96 well assay plate ...
-
bioRxiv - Developmental Biology 2023Quote: ... Relative luminescence units (RLU) were detected on a pre-warmed 37°C EnVision plate reader (Perkin Elmer, Waltham, MA) for 30 min to reach the maximum value ...
-
bioRxiv - Cancer Biology 2023Quote: LM7 cells were seeded in 384-well plates with an optically clear bottom (PerkinElmer, PDL-coated CellCarrier-384 Ultra). The next day ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were washed three times with PBS and bioluminescence measured (luciferin 0.3 mg/mL, Xenogen IVIS 50; Perkin Elmer). We used 24-well transwell inserts and plates (5 μm 29442-118 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 30 min at 37°C with 1000 rpm shaking using a DELFIA plate shaker (Perkin Elmer, Waltham, MA) and placed in a 37°C incubator ...
-
bioRxiv - Neuroscience 2023Quote: ... 5000 cells from each cell line were plated in a 96-well plate (PhenoPlate 96-well, black, Perkin Elmer) according to the layout in Figure 3A ...
-
bioRxiv - Cell Biology 2024Quote: ... we cultured dispersed islet cells from Ins2GFP mice on 384-well glass bottom plates (Perkin Elmer, Waltham, United States) and performed live cell imaging using an ImageXpressMicro environmentally controlled ...
-
bioRxiv - Genetics 2024Quote: ... the FA value was measured at each receptor concentration in a Victor X5 multilabel plate reader (Perkin Elmer, Singapore) using a 480-nm excitation filter and 535-nm emission filters to measure FITC and FAM emission ...
-
bioRxiv - Cell Biology 2019Quote: ... Acquisition was performed on at least 1000 cells per well (3 wells per condition) with 20X objective with Harmony Imaging Software 4.1 (Perkin Elmer). Image analysis was pursued using Colombus 2.5.0 software (Perkin Elmer ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Bioengineering 2019Quote: ... was performed at 24 and 72h (n=3) and cells were imaged using Operetta CLS high-content screening system (PerkinElmer) using 10x magnification and filters for calcein and EthD detection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...