Labshake search
Citations for PerkinElmer :
101 - 150 of 1457 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... in 2.8mm ceramic tubes (Cat# 19-628-3; PerkinElmer, Kennesaw, GA) and pre-chilled 700 μl QIAzol Lysis reagent ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 mg/mouse of D-Luciferin potassium salt (#122799; PerkinElmer Inc.) were injected intraperitoneally 17 min before imaging check ...
-
bioRxiv - Biochemistry 2024Quote: ... and the remaining lysate was mixed with Optiphase HiSafe 3 (PerkinElmer). The radioactivity was monitored using a β-scintillation counter (LSC-8000 ...
-
bioRxiv - Neuroscience 2021Quote: ... d(CH2)5 [Tyr(Me)2,Thr4,Orn8,(125I)Tyr9-NH2] (125I-OVTA, PerkinElmer, Inc.). An adjacent series of slides ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 pmol of DNA was incubated with 2 μL 5 mCi [γ32-P]ATP (PerkinElmer) and 4 μL T4 PNK (New England BioLabs ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Biochemistry 2023Quote: ... 2-[1,2-3H(N)]-deoxy-D-glucose and [1,2-14C]-acetic acid were purchased from PerkinElmer (Waltham, MA, USA). PPARγ ...
-
bioRxiv - Neuroscience 2021Quote: Autoradiographic procedure for the analysis of 3H-2-deoxyglucose (2-DG; 1.5μCi/g body weight, #NET549A001MC, PerkinElmer) localization was adapted from the method by Sokoloff et al ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The level of phosphorylated extracellular signal-regulated protein kinase 1/2 (pERK1/2) was detected using the AlphaScreenTM SureFire Kit (PerkinElmer Life and Analytical Sciences). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 ppm and 1.5 ppm (Multi-element calibration standard 3 for ICP, 10µg/ml, PerkinElmer, L2-20MKBY1). The metal homeostasis analysis is done in Perkin-Elmer Optima 700 DV ICP optical emission spectrometer version 5.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... or 0.1 μM [1-14C]linoleic acid (2 μCi/dish, Perkin Elmer) bound to albumin (1:1 molar ratio ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.4) with 10 μM 2-deoxy-Glucose and 0.5 μCi/mL 3H-2-deoxy-glucose (Perkin Elmer). Cytocholasin B (5 μM ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescence values were measured with a Victor 3 plate reader (Perkin Elmer) and normalized to total protein content ...
-
bioRxiv - Cell Biology 2020Quote: ... The luminescence was measured on a Victor 3 plate reader (Perkin Elmer). The relative ATP levels were calculated by dividing the luminescence by the total protein concentration ...
-
bioRxiv - Developmental Biology 2021Quote: ... we used the TSA Cyanine 3 Plus Evaluation Kit (NEL744E001KT, Perkin Elmer) following the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Color development was performed with TSA plus Cyanine 3 kit (Perkinelmer, NEL744B001KT). The following RNAscope probe was used ...
-
bioRxiv - Molecular Biology 2020Quote: A Victor 3 Multilabel Counter Model 1420 (Perkin Elmer, Waltham, MA, USA) was used for both luminescence and spectrophotometry measurements.
-
bioRxiv - Developmental Biology 2022Quote: ... and signals were detected with TSA plus Cyanine 3 system (Perkin Elmer). Those antibodies were stripped off by antigen retrieval ...
-
bioRxiv - Microbiology 2021Quote: ... The mice were then placed into XIC-3 animal isolation chamber (PerkinElmer) pre-saturated with isoflurane and oxygen mix ...
-
bioRxiv - Immunology 2021Quote: ... The mice were then placed into XIC-3 animal isolation chamber (PerkinElmer) pre-saturated with isothesia and oxygen mix ...
-
bioRxiv - Microbiology 2022Quote: ... The mice were then placed into XIC-3 animal isolation chamber (PerkinElmer) pre- saturated with isothesia and oxygen mix ...
-
bioRxiv - Bioengineering 2020Quote: Bioprinted SK-N-BE(2) spheroids were prepared as described earlier in a 96-well plate (Cell-Carrier, Perkin Elmer). After incubating the plate for 3 days ...
-
bioRxiv - Biochemistry 2024Quote: ... then incubated with Ham’s F-10 media supplemented with 1.5 mCi/well myo[2-3H(N)] inositol (Perkin Elmer/Revvity) for 16-18 h ...
-
bioRxiv - Cell Biology 2020Quote: ... λ-32P-ATP (2 μCi; Perkin Elmer) was included in reactions to enable measurement of phosphorylation during assay optimization using a phosphorimager (Typhoon FLA7000 ...
-
bioRxiv - Systems Biology 2020Quote: ... FITC-TSA (2 min; Perkin Elmer NEL701A001KT), Cy3-TSA (3 min ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-3H]-glucose (Perkin Elmer, Waltham, MA) and 7 mM mannitol containing 0.45 μCi/ml D-[14C]-mannitol (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2022Quote: Multispectral Imaging System version 2 (Perkin Elmer). Briefly ...
-
bioRxiv - Biophysics 2022Quote: ○ 2 μL dCTP [a-32P] (PerkinElmer #BLU513A250UC)
-
bioRxiv - Biochemistry 2023Quote: 2-Deoxy-[3H]glucose was from PerkinElmer. D-[U-14C]glucose was from Moravek Biochemicals ...
-
bioRxiv - Bioengineering 2024Quote: ... A Wizard 2 (Perkin Elmer [Waltham, MA]) or Hidex AMG (Hidex [Turku ...
-
bioRxiv - Cancer Biology 2024Quote: ... [2-14C] acetic acid (Perkin Elmer, NEC553050UC) and 50 µM cold acetic acid (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... Fresh mouse cardiac biopsies (1 biopsy ∼1-3 mg/well) were distributed in a 96-well white microplate (OptiPlate-96; PerkinElmer) and incubated or not (basal ...
-
bioRxiv - Biochemistry 2024Quote: ... Reactions were initiated with the addition of 2 mM ATP containing 2 μCi of ɣ-32p ATP (Perkin Elmer). All reactions were quenched with 2X SDS buffer after an incubation time of 1 hour ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Physiology 2024Quote: Metabolic flux assessment using the Seahorse XFe analyser and 2-[1,2-3H(N)]-deoxy-D-glucose (3H-2DOG; Perkin Elmer, USA) uptake assays were performed on scramble and siPKD1/2/3 transfected 3T3-L1 differentiated adipocytes five days post-differentiation in 24-well plates ...
-
bioRxiv - Biochemistry 2024Quote: ... [1-3H] RuBP was synthetized enzymatically from D-[2-3H] glucose (PerkinElmer, MA) following published protocols47 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Luciferase activity was measured on a Victor 3 multi-label plate reader (PerkinElmer) immediately after the addition of 25μL of luciferin (Promega).
-
bioRxiv - Cell Biology 2022Quote: Images were acquired within 3 days using the Opera Phenix (40x, Perkin Elmer). Automated acquisition of 41 Z-stack per well was performed ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were developed with TSA™ Plus Cyanine 3/Fluorescein System (PerkinElmer) and mounted in ProLong™ Diamond Antifade Mountant plus DAPI (Thermo Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... Dual luciferase signal was quantified using a VICTOR-3 plate reader (Perkin Elmer). To control for transfection efficiency ...
-
bioRxiv - Immunology 2020Quote: ... Whole tumor images were scanned using the Vectra 3 Automated imaging system (PerkinElmer) and quantified using the ImagePro analysis software.
-
bioRxiv - Immunology 2020Quote: ... Luciferase activity was measured on a Victor 3 multi-label plate reader (PerkinElmer) immediately after the addition of 25μL of luciferin (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 3’-end labelled with [α-32P]-cordycepin (3000 Ci/mmol, Perkin Elmer) and terminal transferase (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... Glycolytic flux was also measured by detritiation of [3-3H]-glucose (Perkin Elmer) as described(72) ...