Labshake search
Citations for PerkinElmer :
101 - 150 of 1343 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... was next added and incubated with the mixture at 4 °C for 1 hour before the measurements performed on Envision Readers (PerkinElmer). The fluorescently-labeled m6A-containing mRNA was used to adjust the gain factor ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were blocked with 5% BSA in Tris / HCl-buffered saline / 0.05% Tween (TBST) for 24 h at 4 °C and afterwards membranes were incubated for 1 h with HRP-Streptavidin (PerkinElmer; #NEL750001EA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-plex positive control probe or with a cocktail of Abcb5-C1 and Abcb4-C2 probes with a 1:750 dilution of TSA-Fluorescein Plus and TSA-Cyanine 3 Plus (PerkinElmer, Shelton, CT), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1:3 dilution steps) using a Janus Gripper with 384-channel Modular Dispense Technology dispensing head (revvity, previously Perkin Elmer, MA, USA). Afterwards ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Biochemistry 2023Quote: ... [14C]-palmitic acid (Perkin Elmer) was added to a final activity concentration of 0.2 μCi/mL ...
-
bioRxiv - Cancer Biology 2021Quote: In vitro methyltransferase assays were performed using 30 ul reaction buffer (50 mM Tris-HCl pH 7.8, 50 mM KCl, 5 mM MgCl2) with 1 ul 3H-AdoMet (Perkin Elmer, specifific activity = 55-85 Ci/mMole,0.55 μCi/ul ...
-
bioRxiv - Cell Biology 2020Quote: ... and labeled for 5 min with with 1 μL per OD of cells of EXPRESS 35S Protein Labeling Mix (PerkinElmer) for 5 or 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Neuroscience 2023Quote: ... of incubation in an isotope solution containing rubidium (86Rb+) (1 μCi/ml, 022-105721-00321-0001, POLATOM) and 3H-mannitol (4 μCi/ml, NET101, Perkin Elmer). 86Rb+ acts as a K+ congener ...
-
bioRxiv - Neuroscience 2023Quote: ... Thawed serum samples were diluted with 1xPBS 1:4 and assayed in triplicates using a fluorometer (PerkinElmer, VICTOR3V 1420 Multilabel counter) with excitation/emission of 485 nm / 535 nm (25 nm band-pass filter) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following an HRP conjugation step a TSA Opal 570 1:150 (Tyramide Signal Amplification Opal 4-Color Manual IHC Kit, Perkin Elmer) was linked to the IRF7 antibody previously bound to the slide overnight ...
-
bioRxiv - Immunology 2020Quote: ... often from an ImmPRESS® polymer detection kit followed by colour development using a tyramide signal amplification system kit with cyanine (Cy)3 or fluorescein (1:50 dilution; PerkinElmer, Waltham, MA, USA). For detection of the second antigen in dual immunofluorescence ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: ... CoV-infected cells and control mock-infected cells were incubated for different periods of time with tritiated uridine ([5-3H]uridine, 1 mCi/ml, Perkin Elmer), which was mixed in a 1:1 ratio with double-concentrated medium ...
-
bioRxiv - Cell Biology 2020Quote: ... subconfluent HDLECs cultured in 12-well plates were incubated with 1 ml per well EBM2 medium (containing appropriate amounts of serum and supplement) with [5-3H]-glucose (Perkin Elmer) for 2-3 hours ...
-
bioRxiv - Immunology 2020Quote: We stained 5-µm-thick formalin-fixed paraffin-embedded sections from human xenograft tumors (UMSCC-1) using Opal multiplex kits (PerkinElmer/Akoya), for a panel of DAPI ...
-
bioRxiv - Microbiology 2023Quote: ... collected water samples (50 mL) were immediately spiked with 5 µCi of NaH14CO3 (Perkin Elmer, specific activity 56 mCi mmol−1). The samples were incubated for 24 h under in situ natural illumination ...
-
bioRxiv - Neuroscience 2022Quote: ... Following HRP development, TSA Plus Cyanine3 (Cy3, for Trpa1) and Cyanine 5 (Cy5, for Oprk1) fluorophores (Perkin Elmer, 1:1500 dilution) were applied for 30min at 40°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.5 mg/ml was added 1-hour prior to medium collection and fluorescence intensities were analyzed with plate reader (PerkinElmer 2030).
-
bioRxiv - Microbiology 2022Quote: ... in the ratio of 5:95 and analyzed at mid-IR region (400–4000 cm−1) by FTIR using Spectrum GX (PerkinElmer, USA).
-
bioRxiv - Biophysics 2021Quote: ... 50 nM SpNatC (WT or mutants) was mixed with 50 μM Ac-CoA (14C-labeled, 4 mCi mmol-1; PerkinElmer Life Sciences) and varying peptide concentrations (ranging from 1.95 μM to 500 μM ...
-
bioRxiv - Molecular Biology 2020Quote: 1 μl ml-1 of 0.1 mCi ml-1 14C glucose (PerkinElmer, Cat# NEC042V250UC, Waltham, MA, USA) was added to differentiation medium 48 h before the end of the experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 3H-labelled SAM (1 mCi/ml; PerkinElmer) was added to the mixture and then incubated at 30°C for 1 h with gentle shaking ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Physiology 2020Quote: ... [9,10-3H(N)]-oleic Acid (PerkinElmer) or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated for 10 min in Cy3 Plus Amplification Reagent diluted 1:300 in 1x Plus Amplification Diluent (TSA Plus Cyanine 3 System, Perkin Elmer, Waltham, MA, NEL744001KT), washed several times in TBS with 0.3% Triton X-100 and 0.05% Tween 20 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ligand-stimulated cAMP accumulation in the presence or absence of 0.5 mM 3-isobutyl-1-methylxanthine (IBMX) was measured after the indicated times of stimulation using LANCE® cAMP Detection Kit (Perkin Elmer Life Sciences) and a Mithras LB 940 multimode microplate reader ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were fixed with 2% PFA at RT for 30 min and stained with the Hoechst 33342 dye (1 μg/ml) at 37 °C and 5% CO2 before imaging with the Operetta™ high content imaging system (PerkinElmer Inc.). Forty fields were acquired from each well using appropriate filter sets ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... All the videos (2 min, 4 frames s-1) were acquired at 37 °C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were treated with 1 μCi 1-14C (Perkin Elmer, NEC043X050UC) or 6-14C glucose (Perkin Elmer ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Neuroscience 2022Quote: ... siScrambled or siAbdc1/2 Astrocytes were incubated overnight with DMEM without glucose supplemented with 1% FBS containing 1 μCi/mL 14C-Acetate ([1-14C] acetate, 58 mCi/mmol, PerkinElmer) and or α-cyclo or 50 μM C26:0 ...
-
bioRxiv - Cell Biology 2024Quote: ... and membranes were incubated 1 min with in a 1:1 mixture of ECL solutions A and B (PerkinElmer, USA). Excess ECL solution was removed ...
-
bioRxiv - Plant Biology 2020Quote: ... were translated in WGE in a total volume of 12.5 µl with amino acids mixture or [35S]-methionine amino acid mixture (Ct= 3.06 μCi/0.14 MBq, 5.8 Ci/mmol, Perkin Elmer), 93 mM potassium acetate ...
-
bioRxiv - Pathology 2022Quote: Fatty acid uptake and incorporation into lipids as well as de novo lipogenesis were determined using [9,10-3H(N)]-oleic acid and [1,2-14C]-acetic acid (PerkinElmer), respectively ...
-
bioRxiv - Physiology 2021Quote: ... 4.5µCi 3H-oleic acid (NET289001MC, Perkin Elmer), was dried down under N2 then resuspended in PBS and combined 1:1 with 40% fatty-acid free bovine serum albumin to a final volume of 200µl ...
-
bioRxiv - Biophysics 2023Quote: ... Radioactive amino acids are purchased from PerkinElmer. Other reagents are from Millipore Sigma if not specified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... on a Chemagic360 nucleic acid extractor (PerkinElmer) with a 96-well rod head after samples were homogenized using a steel ball in lysis buffer ...