Labshake search
Citations for PerkinElmer :
1101 - 1150 of 1364 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... the reaction was stopped using 5 µL 40 µM EDTA in 1X LANCE Detection buffer (Perkin Elmer, CR97-100) for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... 5 μL of the IgG supernatants were transferred to an OptiPlate-384 assay plate (white opaque, PerkinElmer, Waltham, MA), mixed with 10μL (10 nM final conc. ...
-
bioRxiv - Immunology 2021Quote: ... Immunohistochemistry was performed in Tris/NaCl blocking buffer (0.1□M Tris-HCl, 0.15□M NaCl, 5□μg/ml blocking reagent (Perkin Elmer), pH 7.5 ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: Autophosphorylation of YegI and point mutants was performed by addition of 5 μCi of [γ-32P] ATP (Perkin Elmer) to 0.2 μM of purified YegI or YegI point mutants in 10 μl of reaction buffer containing 50 mM Tris pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with a total length of 109 ntb was prepared by 5′-end-labelling using [γ-32P]- ATP (Perkin Elmer) and T4 polynucleotide kinase (Thermo Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... were collected from the CA1 SR from ≥5-7 sections per slice and processed for iterative deconvolution (99% confidence; Volocity 4.0, PerkinElmer). Three dimensional (3-D ...
-
bioRxiv - Biochemistry 2024Quote: ... The dry filter papers were placed in scintillation vials with 5 ml Ultima Gold F scintillation cocktail (Perkin Elmer) and scintillation was measured in a TriCarb 2900TR liquid scintillation analyzer (Perkin Elmer).
-
bioRxiv - Genomics 2023Quote: ... The metabolite extract was transferred into scintillation vials with 5 mL Insta-Gel Plus scintillation cocktail (Perkin Elmer #601339).
-
bioRxiv - Cancer Biology 2022Quote: ... and maintained in 2.5 mL of KSFM supplemented with 5% (v/v) charcoal-stripped FBS and 50 nM R1881 (PerkinElmer) 25 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 the luciferase activity was measured on Centro LB 960 Microplate Luminometer (Berthold Technologies) using Britelite PlusTM (PerkinElmer) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified RNA oligos were either phosphorylated with unlabeled ATP or 5’ end-labeled using [γ-32P] ATP (Perkin Elmer) and T4-Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: Overnight cultures were diluted to an OD600 of ∼0.05 in 10 mL LB Miller broth supplemented with 5 µCi/mL 32P ortho-phosphoric acid (PerkinElmer) and grown until reaching an OD600 of ∼0.6 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... columns 2-23 were used) of tissue-culture treated black CellCarrier-384 Ultra Microplates (Perkin Elmer 6057302) using a 12-channel electronic multichannel 200 μL pipettor [Sartorius] ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were loaded with 2 μCi/ml D-[2,3-3H]aspartate (Perkin Elmer, Waltham, MA, cat. #NET50100) in MEM +HIHS cell culture medium ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µL of cell culture medium or standard solution was added to an Optiplate-384 microplate (PerkinElmer). 21µL of 10X mixture including acceptor beads and biotinylated antibody was then added to the wells with culture media or standard solution ...
-
bioRxiv - Microbiology 2024Quote: ... and the luminescent signal was measured with an IVIS Lumina II (Perkin Elmer; 2-min exposure time). The luminescent signal was quantified with Living Image software (Perkin Elmer ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Radiolabeled [U-14C] palmitic and [2-14C] acetic acids were purchased from PerkinElmer (Villebon-Sur-Yvette, France). RIPA buffer 10X (9806-Cell Signaling ...
-
bioRxiv - Developmental Biology 2024Quote: ... The heads were rinsed five times in PBST at room temperature and then incubated in 50x diluted Cy3 Tyramide Reagent (PerkinElmer Life Science, Inc. 1:50 dilution) in Amplification Dilution buffer for 90 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... where reactions were incubated with 150 nM of the gel-filtration purified WT mouse Naa10 or Naa12 in a 30 µl reaction volume containing each 250 µM substrate peptide and radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences) for 12 min (Naa12 ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Half of the cell Triton X lysate from each well was pipetted into a scintillation vial and 4 ml of scintillation fluid (#6013329, Ultima GoldTM, Perkin Elmer, USA) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... were prepared in in vitro transcription reaction on linear PCR-generated template containing RNAImod (4) with 500 μM ATP or NAD and 25 μM [α 32P] CTP (Perkin Elmer) using hexa-histidine tagged E ...
-
bioRxiv - Microbiology 2024Quote: ... Mixtures were incubated for 60 min at room temperature prior to adding 4 µl of D-luciferin (30 mg/ml) (Perkin Elmer; #122799). After additional incubation for 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... the plates containing infected macrophages were incubated at 37°C with 5% CO2 for 18 h in an Operetta High-Content Imaging System (PerkinElmer). During this 18 h incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were incubated for 5 minutes at 37°C with 55µCi/well of 35S-L-methionine and 35S-L-cysteine Promix (Perkin Elmer) in a minimal volume of culture medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cell motility was acquired using temperature (37°C) and CO2 (5%) controlled Operetta CLS High-Content Analysis System (PerkinElmer, HH16000000) (non-confocal ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Spectra were analysed using OPUS 6.5 software (Bruker) and compared with RMIT University’s spectral library of organic compounds generated using Spectrum 10 software (Perkin Elmer). Fingerprint spectra shown in Figure 4D were prepared using GraphPad Prism.
-
bioRxiv - Microbiology 2021Quote: ... 1.37 μg/mL of RBD and 5 μg/mL of Ecto) and incubated overnight in protein-binding 96-well plates (PerkinElmer). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... plates were centrifuged once more under same conditions mentioned above and 5 µL of each FRET antibody pair was added (2.5 nM final concentration for donor and 5 nM for acceptor, diluted in 1x Lance buffer, (Perkin Elmer)) ...
-
bioRxiv - Microbiology 2021Quote: ... and fluorescence at 355 nm excitation and 460 nm emission was monitored every 5 minutes for 50 minutes using an Envision plate reader (PerkinElmer). Rate of substrate cleavage was determined using linear regression of the raw data values obtained during the time course ...
-
bioRxiv - Microbiology 2022Quote: ... was phosphorylated in vitro with His-MBP-PknBMtb at 0.015 μg/μl for 30 minutes at room temperature with 0.15μCi/μl ATP [γ-32P] (5×10-8 μmol) (3000Ci/mmol, 10mCi/ml, PerkinElmer BLU002A250UC) and 2mM MnCl2 in buffer (50mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... Nifene or nicotine respectively for 5 min followed by addition of 2.5 nM [125I]-epibatidine ([125I]Epb) (2200 Ci/mmol; Perkin Elmer) and incubation for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Emission intensity was recorded for 5 min using 460 nm and 530 nm filters on the EnVision or Victor X Light plate reader (PerkinElmer). Next ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed with the DNA absorption solution (for one sample: 50 uL 5 M NaCl, 15 ul magnetic beads (GMG-252-A-100mL – PerkinElmer), 250 uL 7.8 M guanidium chloride ...