Labshake search
Citations for PerkinElmer :
51 - 100 of 1614 citations for 6 Chloro 2 3 4 5 tetrahydro 7 8 dimethoxy 1 4 methoxyphenyl 1H 3 benzazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Bacterial burden in MRSA /ux-infected mouse ears was monitored every 24 h for 3 or 7 consecutive days using an In Vivo Imaging System (IVIS) Spectrum (Perkin Elmer). Bacterial burden was quantified as the bioluminescence (radiance ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA samples were separated on a 7 M urea denaturing polyacrylamide gel at 4°C at 100V and transferred onto a charged nylon transfer membrane (PerkinElmer), followed by cross-linking using a UV Stratalinker and drying at 80°C on a Gel Dryer (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3H-mannitol (4 µCi ml−1, NET101, Perkin Elmer), the latter serves as an extracellular marker 33 ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then separated on a HayeSep column (7’ HayeSep N 1/8’’ Sf; PerkinElmer Inc., Waltham, USA), followed by molecular sieve (9’ Molecular Sieve 13x 1/8’’ Sf ...
-
SPNS1 is required for the transport of lysosphingolipids and lysoglycerophospholipids from lysosomesbioRxiv - Biochemistry 2022Quote: ... and lower phase (containing [3-3H]-sphingosine, [3-3H]-ceramides, [3-3H]-SM) were quantified by a scintillation counter (Perkin Elmer Tri-Carb Liquid Scintillation Analyzer).
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μL γ32P-dATP (Perkin Elmer), and 5 μL H2O for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... 3 pM GTP α-32P (PerkinElmer), 10 Units of VCE and incubated 30 min at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.5 ml Optiphase HISAFE 3 (PerkinElmer) was incubated with the filter overnight before liquid scintillation counting with MicroBeta JET (PerkinElmer) ...
-
bioRxiv - Genomics 2022Quote: ... and TSA Plus Cyanine 3 (PerkinElmer). After the last washing step ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 10% BSA and 3 µl [35S] EasyTag Express protein labelling mix (7 mCi, 259 MBq, 1175 Ci/mmol in 632 ml; Perkin Elmer, Espoo, Finland). After 2 h of incubation at 37 °C cells were washed twice with PBS ...
-
bioRxiv - Pathology 2023Quote: ... double immunohistochemistry for paraffin sections (8 μm) was conducted by using the Opal 4 color manual immunohistochemistry (IHC) kit (NEL810001KT, PerkinElmer). The signal of p-MLC2 was amplified by the Opal 4 color manual IHC kit (NEL810001KT ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 µM S-adenosyl Methionine (1 µM 3H-SAM (Perkin Elmer); 3 µM cold SAM ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Systems Biology 2023Quote: ... Finally 100 μl sample was added to scint vials containing 3 mls scintillant (OptiPhase HiSafe 3, Perkin Elmer). β-radioactivity was measured with Tri-Carb 4910TR liquid scintillation counter.
-
bioRxiv - Developmental Biology 2020Quote: ... 1: 5000 followed by incubation with 1:50 to 1: 100 TSA plus Cyanine 3 solution (Perkin Elmer). To detect two genes at a time ...
-
bioRxiv - Neuroscience 2020Quote: HUVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Systems Biology 2020Quote: ... Cy3-TSA (3 min; Perkin Elmer NEL744001KT), Cy5-TSA (7 min ...
-
bioRxiv - Microbiology 2021Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Immunology 2021Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μL 35S-labeled methionine (PerkinElmer NEG709A500UC), 2.5 μL recombinant protein (~450ng ...
-
bioRxiv - Microbiology 2022Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... All the videos (2 min, 4 frames s-1) were acquired at 37 °C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... the sections were incubated with diluted TSA plus Cy-3 (1:750, PerkinElmer, #NEL741001KT) for 30 minutes at 40°C in the oven ...
-
bioRxiv - Immunology 2019Quote: ... After 4-6 washes with 1x TBST the membrane was treated with chemiluminescent substrate Western Lightning ECL Pro (Perkin Elmer; NEL120001EA) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 4 μL/well of ATPLite (PerkinElmer) was added to assay plates and incubated for 15 min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 μL/well of ATPLite (PerkinElmer) was dispensed ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl/well of ATPLite (PerkinElmer) was added to assay plates and incubated for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Immunology 2024Quote: ... Tumor progression was subsequently monitored every 2-3 days using caliper measurement and the IVIS Spectrum imaging system (PerkinElmer) to measure bioluminescent signal after intraperitoneal administration of 0.15 mg of luciferin substrate per gram of body weight (PerkinElmer 122799) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-D reconstruction was performed with Volocity (PerkinElmer).
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was mixed with Optiphase Hisafe 3 (PerkinElmer), and radioisotope activity was monitored by LSC-8000 β-scintillation (Hitachi) ...
-
bioRxiv - Neuroscience 2020Quote: ... then incubated in TSA plus cyanine 3 (Perkin Elmer) for 10 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... A Vectra 3 pathology imaging system microscope (PerkinElmer, Inc.) was used to obtain images ...
-
bioRxiv - Neuroscience 2020Quote: ... The luminescent intensity was measured with VICTOR 3 (PerkinElmer), and the values were normalized to the MAO B protein level measured by Western blotting.
-
bioRxiv - Neuroscience 2019Quote: ... Sections were rinsed 3 times for 2 min in PBS-Tx and incubated in tyramide signal amplification (TSA) blocking reagent (PerkinElmer, FP1012) in PBS-Tx (TSA-block ...
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...
-
bioRxiv - Neuroscience 2019Quote: ... were transfected into the indicated cells (HEK293/17: 4×105/well; CHO: 2.5×104/well, BMVECs: 5×103/well) in 96-well plates (PerkinElmer, 6005680) in triplicate ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μM UTP) and 4 μCi of [α-32P]UTP (3000 Ci/mmol; Perkin Elmer), allowed to proceed for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1×10^4 LN-229 cells were plated in CellCarrier-96 Ultra Microplates (PerkinElmer, #6055302) and incubated overnight in reduced serum media at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were then processed for visualization using the RNA-scope Multiplex Fluorescent reagent Kit v2 (Advanced Cell Diagnostics) and the Tyramide Signal Amplification (TSA™) Plus Cyanine 3 and TSA Plus Cyanine 5 systems (Perkin Elmer).
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...