Labshake search
Citations for PerkinElmer :
51 - 100 of 715 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.56 µM S-adenosyl-L-[methyl-3H]methionine with a specific activity of 18 Ci/mmol (PerkinElmer), 1.96 µM nonradioactive SAM ...
-
bioRxiv - Genetics 2020Quote: ... DNA methylation was measured by the incorporation of tritiated methyl groups from radioactively labeled SAM (Perkin Elmer) into the biotinylated substrate using an avidin–biotin methylation plate assay47 ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.56 µM S-adenosyl-L-[methyl-3H] methionine with a specific activity of 18 Ci/mmol (PerkinElmer), 1.96 µM nonradioactive SAM ...
-
bioRxiv - Biochemistry 2023Quote: ... [14C]-palmitic acid (Perkin Elmer) was added to a final activity concentration of 0.2 μCi/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated for 1h in methionine (Met)- and cysteine (Cys)-free DMEM supplemented with 250μCi of 35S-Met/Cys radiolabel (PerkinElmer) per condition at normoxia ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubated 1h in blocking buffer and then incubated overnight with an anti-DNP-POD antibody (1:1000, Perkin Elmer). The next day embryos were washed in PBS-Tween ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Hoechst (1µg/ml) for 1h at room temperature before washing with PBS and analysing on the Operetta CLS (PerkinElmer). Cells were imaged at 10X using the following channels ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... target cells were loaded with an acetoxymethyl ester of the fluorescence-enhancing ligand (BATDA; Perkin Elmer #C136-100) and then co-cultured at 10,000 cells/well in triplicate with effector cells at the indicated E:T ratios ...
-
bioRxiv - Physiology 2020Quote: ... [9,10-3H(N)]-oleic Acid (PerkinElmer) or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were sacrificed 1h post-injection to quantify the fluorescence intensity of the organs ex-vivo with IVIS Lumina III (Perkin Elmer).Average of fluorescent photons per lung were quantify as radiant ef-ficiency [photon/second/cm2/sr] / [µW/cm2] ...
-
bioRxiv - Biochemistry 2021Quote: ... Complexes were incubated for 1h at 37°C and luminescence released by the [14C]-RITA-excited beads was measured in standard microplate reader (Perkin Elmer).
-
bioRxiv - Microbiology 2021Quote: ... The plate was then incubated for 1h at RT in the dark before the AlphaLISA signal was detected using an EnSpire Multimode Plate Reader (Perkin Elmer). Negative control with binding buffer was used to control the assay quality ...
-
bioRxiv - Neuroscience 2021Quote: ... Scintillation fluid was added and filters were agitated for 1h and counted in Wallac Tri-Lux β-scintillation counter (Perkin Elmer). Binding data were analysed by non-linear regression analysis assuming one-site binding (GraphPad Prism 5.0).
-
bioRxiv - Physiology 2021Quote: ... acylcarnitines were derivatized to their butyl esters and treated with the reagents of the NeoGram MSMS-AAAC kit (PerkinElmer). Their analysis was carried out on a Waters 2795/Quattro Micro AP liquid chromatography–tandem mass spectrometer (Waters ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Plant Biology 2020Quote: ... were translated in WGE in a total volume of 12.5 µl with amino acids mixture or [35S]-methionine amino acid mixture (Ct= 3.06 μCi/0.14 MBq, 5.8 Ci/mmol, Perkin Elmer), 93 mM potassium acetate ...
-
bioRxiv - Microbiology 2023Quote: Measurements of fatty acid biosynthesis were performed by measuring the incorporation of (1-14C) acetic acid (Perkin Elmer) into cellular lipids as described previously(Spencer et al. ...
-
bioRxiv - Pathology 2022Quote: Fatty acid uptake and incorporation into lipids as well as de novo lipogenesis were determined using [9,10-3H(N)]-oleic acid and [1,2-14C]-acetic acid (PerkinElmer), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... Of each sample three replicates and two formaldehyde-fixed (final conc. 1.85 %) adsorption blanks were spiked with [methyl-3H]-thymidine and L-[14C(U)]-leucine (Perkin Elmer) at saturating concentrations of 20 nM and 150 nM ...
-
bioRxiv - Genomics 2023Quote: ... at a total concentration equivalent to 0.8 μM nucleosomes and 5.0 μM 14C-SAM (S- [methyl-14C]-adenosyl-l-methionine (PerkinElmer, no. NEC363050UC)) ...
-
bioRxiv - Physiology 2021Quote: ... 4.5µCi 3H-oleic acid (NET289001MC, Perkin Elmer), was dried down under N2 then resuspended in PBS and combined 1:1 with 40% fatty-acid free bovine serum albumin to a final volume of 200µl ...
-
bioRxiv - Biophysics 2023Quote: ... Radioactive amino acids are purchased from PerkinElmer. Other reagents are from Millipore Sigma if not specified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... on a Chemagic360 nucleic acid extractor (PerkinElmer) with a 96-well rod head after samples were homogenized using a steel ball in lysis buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... [U-14C]palmitic acid (Perkin Elmer, NEC534050UC), 100 µM cold palmitic acid (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... [2-14C] acetic acid (Perkin Elmer, NEC553050UC) and 50 µM cold acetic acid (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... (Figure S1) Its chemical structure was confirmed by 1H-NMR (Mercury 400, Varian, Palo Alto) and FTIR (Spectrum One, Perkin Elmer, Waltham) shown in Figure S2.
-
bioRxiv - Molecular Biology 2020Quote: ... The 3’TAMRA fluorescence from 5’UAR was recorded by a single molecule avalanche photodiode (SPAD) (SPCM-AQR-14, PerkinElmer Optoelectronics, Quebec, Canada), through a 600/50 band pass emission filter ...
-
bioRxiv - Cell Biology 2020Quote: ... the wells were pulsed with 1 μCi/well of [methyl-3H]TdR (70–90 Ci/mmol; NEN Radiochemicals, PerkinElmer, Akron, OH). After 16 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1mM PMSF, 100mM KCl and 1 mCi of [3H]AdoMet (S-adenosyl-L-[methyl-3H] methionine, 80 Ci/mmol; SAM) (Perkin Elmer) or 0.15mM unlabeled S-adenosyl methionine for 45 min at 30°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... the SPOT arrays were incubated in methylation buffer containing additionally 50 nM SETD6 and 0.76 µM labelled [methyl-3H]-AdoMet (Perkin Elmer Inc.) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... subconfluent HDLECs cultured in 12-well plates were incubated with 1 ml per well EBM2 medium (containing appropriate amounts of BSA, carnitine, and cold palmitic acid) with [9,10-3H]-palmitic acid (Perkin Elmer) for 6 hours ...
-
bioRxiv - Systems Biology 2023Quote: ... Free amino acids were determined with the EZ:FAAST amino acid analysis kit of Phenomenex on a GC-FID (Perkin Elmer) according to supplier instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... cyanine 3 (PerkinElmer #NEL744E001KT), and cyanine 5 (PerkinElmer #NEL745E001KT) ...
-
bioRxiv - Biochemistry 2020Quote: ... alongside 375 μCi 32P orthophosphoric acid (PerkinElmer, #NEX053010MC) were added and left to induce overnight.
-
bioRxiv - Microbiology 2023Quote: ... alongside 375 µCi 32P orthophosphoric acid (PerkinElmer, #NEX053010MC) were added and left to induce overnight ...
-
bioRxiv - Molecular Biology 2023Quote: DNA methylation of replicating sperm or erythrocyte nuclei in egg extract was assayed by the incorporation of 3H-SAM (S-[methyl-3H]-adenosyl-L-methionine; Perkin Elmer, NET155H). Demembranated sperm nuclei were prepared as published previously (86) ...
-
bioRxiv - Physiology 2023Quote: ... and 125 uM of 14C-labeled palmitic acid (PerkinElmer). 14C-labeled products were separated from the reactions by extraction with chloroform/methanol as previously described (32) ...
-
bioRxiv - Zoology 2022Quote: ... Volatile fatty acids were analysed by gas chromatography using crotonic acid as internal standard on a Perkin Elmer Clarus 580 GC (Perkin Elmer, Courtaboeuf, France) equipped with a Stabilwax-DA column (30 m by 0.53 mm i.d. ...
-
bioRxiv - Developmental Biology 2020Quote: Recombinant GST-SRF protein or synthetic SRF peptides were incubated for 3 h at 30 °C with GST-SET7 in the presence of 100 nCi of S-adenosyl-[methyl-14C]-L-methionine [14C-SAM] (Perkin Elmer, Waltham, MA, USA) in HMTase assay buffer (50 mM Tris–HCl [pH 8.5] ...