Labshake search
Citations for PerkinElmer :
51 - 100 of 1044 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Plant Biology 2023Quote: ... resuspended in 2 N NaOH and mixed with 5 volumes scintillation fluid (Ultima Gold™ XR, PerkinElmer) for 14C-CPM counting in a TRI-CARB liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Physiology 2020Quote: ... [9,10-3H(N)]-oleic Acid (PerkinElmer) or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Neuroscience 2024Quote: ... The various agents used were injected in a volume of 5 µl using an internal cannula (Invivo1, part #C313IS-5/SPC, Internal Canula, 28 gauge) connected to plastic tubing (Perkin Elmer, Cat#N0695476, 2-stop, I.D. 0.19 mm) and a 10 µl glass syringe (Hamilton ...
-
bioRxiv - Neuroscience 2020Quote: HUVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...
-
bioRxiv - Plant Biology 2020Quote: ... were translated in WGE in a total volume of 12.5 µl with amino acids mixture or [35S]-methionine amino acid mixture (Ct= 3.06 μCi/0.14 MBq, 5.8 Ci/mmol, Perkin Elmer), 93 mM potassium acetate ...
-
bioRxiv - Pathology 2022Quote: Fatty acid uptake and incorporation into lipids as well as de novo lipogenesis were determined using [9,10-3H(N)]-oleic acid and [1,2-14C]-acetic acid (PerkinElmer), respectively ...
-
bioRxiv - Microbiology 2023Quote: Measurements of fatty acid biosynthesis were performed by measuring the incorporation of (1-14C) acetic acid (Perkin Elmer) into cellular lipids as described previously(Spencer et al. ...
-
bioRxiv - Physiology 2021Quote: ... 4.5µCi 3H-oleic acid (NET289001MC, Perkin Elmer), was dried down under N2 then resuspended in PBS and combined 1:1 with 40% fatty-acid free bovine serum albumin to a final volume of 200µl ...
-
bioRxiv - Biophysics 2023Quote: ... Radioactive amino acids are purchased from PerkinElmer. Other reagents are from Millipore Sigma if not specified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... on a Chemagic360 nucleic acid extractor (PerkinElmer) with a 96-well rod head after samples were homogenized using a steel ball in lysis buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... [U-14C]palmitic acid (Perkin Elmer, NEC534050UC), 100 µM cold palmitic acid (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 nM of hNatD was mixed with 2 μM of radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences), 20 μM of the peptide ...
-
bioRxiv - Bioengineering 2024Quote: ... was injected subcutaneously (Figure 2) or intraperitoneally (Figure 4) into mice and bioluminescence imaging was performed using IVIS Lumina series III (PerkinElmer). During the measurement ...
-
bioRxiv - Neuroscience 2020Quote: ... or a linear OXTR antagonist [125I]-d(CH2)5[Tyr(Me)2-Tyr-Nh2]9-OVT (Perkin Elmer, USA) as tracers ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 24-well plates for 2 h with 0.25 ml/well of fresh growth medium containing 5 μCi/ml [3H]adenine (PerkinElmer). The medium was then replaced with 0.5 ml/well of DMEM containing 20 mM HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... we administered four intraperitoneal injections of 3H-Thy at 2 hrs intervals to adult mice (1.67 μL/g body weight, specific activity 5 Ci/mmol; PerkinElmer) with subsequent perfusion 2 hrs after the last injection (n = 3) ...
-
bioRxiv - Neuroscience 2024Quote: HB(T)MVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 3’TAMRA fluorescence from 5’UAR was recorded by a single molecule avalanche photodiode (SPAD) (SPCM-AQR-14, PerkinElmer Optoelectronics, Quebec, Canada), through a 600/50 band pass emission filter ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of each phase were collected and measured in a 2480 automatic Gamma counter Wizard 2 3” (PerkinElmer, Waltham, MA, USA). LogD value were calculated using Excel by dividing measured values of octanol by water and logarithmize the result ...
-
bioRxiv - Microbiology 2022Quote: ... were performed in a HORIBA JOBIN YVON Spectrofluorometer (FluoroMax – 4) (HORIBA Scientific, Edison, New Jersey, USA) in a fluorescence cuvette of path length 5 mm (Perkin Elmer B0631123), after putting 0.5ml of the sample solution in it ...
-
bioRxiv - Neuroscience 2023Quote: ... The choroid plexus was subsequently swiftly rinsed in cold isotope-free HEPES-aCSF containing 2 mM ouabain (4°C) and transferred to a scintillation vial and dissolved in 100 μl Solvable (6NE9100, Perkin Elmer). For the light and dark phase influx experiment ...
-
bioRxiv - Neuroscience 2024Quote: ... and counted for 2 min after a 4 hr delay on a Perkin Elmer Betaplate 1205 liquid scintillation counter (Perkin Elmer). Nonspecific binding was determined with 1.0 µM dihydroergotamine.
-
bioRxiv - Cell Biology 2020Quote: ... subconfluent HDLECs cultured in 12-well plates were incubated with 1 ml per well EBM2 medium (containing appropriate amounts of BSA, carnitine, and cold palmitic acid) with [9,10-3H]-palmitic acid (Perkin Elmer) for 6 hours ...
-
bioRxiv - Systems Biology 2023Quote: ... Free amino acids were determined with the EZ:FAAST amino acid analysis kit of Phenomenex on a GC-FID (Perkin Elmer) according to supplier instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... cyanine 3 (PerkinElmer #NEL744E001KT), and cyanine 5 (PerkinElmer #NEL745E001KT) ...
-
bioRxiv - Biochemistry 2020Quote: ... alongside 375 μCi 32P orthophosphoric acid (PerkinElmer, #NEX053010MC) were added and left to induce overnight.
-
bioRxiv - Microbiology 2023Quote: ... alongside 375 µCi 32P orthophosphoric acid (PerkinElmer, #NEX053010MC) were added and left to induce overnight ...
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence Imaging and Quantification: Mice were anesthetized with isoflurane (2-3% in 100% oxygen) and bioluminescence images acquired with an IVIS Spectrum (Perkin Elmer, Waltham, MA) 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer ...
-
bioRxiv - Cell Biology 2021Quote: ... was monitored every 5 min for 2 h at 37°C using a fluorescent plate reader (EnSpire Multimode Plate Reader, Perkin Elmer). Samples were assayed in technical triplicates and in biological replicates as indicated in the figure legend.
-
bioRxiv - Genetics 2022Quote: ... Probe for southern blot was amplified with primers listed in table S1 and then labeled using [α-32P] 2’-deoxycytidine 5’-triphosphate (dCTP) (PerkinElmer) with Klenow fragment (3’-5’ exo- ...
-
bioRxiv - Physiology 2023Quote: ... and 125 uM of 14C-labeled palmitic acid (PerkinElmer). 14C-labeled products were separated from the reactions by extraction with chloroform/methanol as previously described (32) ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... All the videos (2 min, 4 frames s-1) were acquired at 37 °C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Cell Biology 2021Quote: ... Then it was mixed with reaction B which contain 5 μg of the GST-substrate in 5x Kinase buffer containing 2 μCi γ-32P-ATP (PerkinElmer, BLU002Z250UC) in 10-μl reactions ...
-
bioRxiv - Zoology 2022Quote: ... Volatile fatty acids were analysed by gas chromatography using crotonic acid as internal standard on a Perkin Elmer Clarus 580 GC (Perkin Elmer, Courtaboeuf, France) equipped with a Stabilwax-DA column (30 m by 0.53 mm i.d. ...
-
SPNS1 is required for the transport of lysosphingolipids and lysoglycerophospholipids from lysosomesbioRxiv - Biochemistry 2022Quote: ... and lower phase (containing [3-3H]-sphingosine, [3-3H]-ceramides, [3-3H]-SM) were quantified by a scintillation counter (Perkin Elmer Tri-Carb Liquid Scintillation Analyzer).
-
bioRxiv - Biochemistry 2020Quote: ... 3 μL γ32P-dATP (Perkin Elmer), and 5 μL H2O for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... 3 pM GTP α-32P (PerkinElmer), 10 Units of VCE and incubated 30 min at 37°C.