Labshake search
Citations for PerkinElmer :
51 - 100 of 1501 citations for 2' Chloro 4 5 5 dimethyl 1 3 dioxan 2 yl butyrophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Microbiology 2021Quote: ... 5-6[3H] (Perkin Elmer) (6 µCi/mL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cyanine 5 (PerkinElmer #NEL745E001KT). Sections were then incubated in 1X Trueblack Lipofuscin Autofluorescence Quencher (VWR #10119-144 ...
-
bioRxiv - Neuroscience 2022Quote: ... D-[5-3H(N)] (PerkinElmer). Cells were incubated for 4 and 6 h after which cell supernatants from duplicate plates were collected at each respective time-point and stored at −20 °C ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... All the videos (2 min, 4 frames s-1) were acquired at 37 °C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Genomics 2020Quote: ... and labeled with TSA Cyanine 5 (Perkin Elmer #NEL705A001KT, 1:1000 dilution). Next ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μM cold ATP and 5 μCi [γ32P] - ATP (Perkin Elmer, USA). The reaction was incubated for 30 minutes at 30°C and stopped by adding Laemmli buffer and boiling at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µCi of [1-14C] acetate (NEC084H001MC, Perkin Elmer, Waltham, MA, USA) per mL was added and the cells were cultured for four more hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Cat.#AL000F; PerkinElmer). For calibration ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Perkin Elmer, #AL000F). A 2-fold serial dilution of imiglucerase (Genzyme ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2’-14C]-cystine (PerkinElmer) for 5 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μCi 3H-adenosine (Perkin Elmer), or 10 μM EdA was supplemented ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μCi [3H]OA (Perkin Elmer) + 0.4 mM OA/0.5% BSA complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μCi [γ-32P] ATP (PerkinElmer) and 10 units T4 PNK enzyme (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µCi/ml [3H]-cholesterol (PerkinElmer) was added in the presence of 10% FBS ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µM [methyl-3H] SAM (PerkinElmer), 10 µM substrate RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Biochemistry 2021Quote: ... or 0.1 μM [1-14C]linoleic acid (2 μCi/dish, Perkin Elmer) bound to albumin (1:1 molar ratio ...
-
bioRxiv - Molecular Biology 2021Quote: ERK1/2 phosphorylation was detected with the AlphaScreen SureFire ERK1/2 assay kit (PerkinElmer). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... was added to control wells before addition of 2-[3H]deoxyglucose (2-DG) (PerkinElmer). During the final 5 min 2-DG (0.25 μCi ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM DTT and 2 μCi/mL S-adenosyl-L-[methyl-14C] methionine (PerkinElmer). After 3h incubation ...
-
bioRxiv - Cell Biology 2024Quote: ... a glucose uptake tracer (14 C-2-deoxyglucose (2-DG) (Perkin Elmer, cat # NEC495001MC) was administered as a single bolus at a dose of 13 μCi over 1 minute at 75 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The level of phosphorylated extracellular signal-regulated protein kinase 1/2 (pERK1/2) was detected using the AlphaScreenTM SureFire Kit (PerkinElmer Life and Analytical Sciences). Briefly ...
-
bioRxiv - Bioengineering 2021Quote: ... A Wizard 2 (Perkin Elmer) gamma counter was used to quantify tracer uptake in organs ...
-
bioRxiv - Cell Biology 2021Quote: ... 2’-14C]-Cystine (PerkinElmer, NEC854010UC) and washed three times in ice-cold PBS containing cold cystine (1 mM) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Staining was visualized with DAB or TSA Plus Cyanine 5 (NEL745001KT, PerkinElmer; 1:750). Combined ISH and immunofluorescence (IF)/immunohistochemistry (IHC ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL of each component was added to 2 mL Ultima Gold scintillation fluid (PerkinElmer), and radioactivity counted on the MicroBeta2 scintillation counter (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... TSA Plus Cyanine 5 (NEL763001KT, Perkin Elmer) was used to visualize ...
-
bioRxiv - Physiology 2023Quote: ... 5 mL of Insta-gel Plus (PerkinElmer) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... [1-3H] RuBP was synthetized enzymatically from D-[2-3H] glucose (PerkinElmer, MA) following published protocols47 ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM MgCl2 and 1 mM DTT) supplemented with 0.76 μM radioactively labelled AdoMet (PerkinElmer) for 4 h at 37 °C or overnight at 25 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM MgCl2 and 1 mM DTT) supplemented with 0.76 μM radioactively labelled AdoMet (PerkinElmer) for 4 h at 37 °C or overnight at 25 °C ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 106 treated cells were incubated with 2 MBq of Na2 CrO4 (#NEZ030001MC, PerkinElmer, Waltham, MA) for 2 hours at 37 °C in a 5% CO2 atmosphere and were used as target cells ...
-
bioRxiv - Neuroscience 2024Quote: ... 2×2 binning) were aquired using Operetta CLS high content imaging system (PerkinElmer; Waltham, MA, USA) using a 20x air objective and Hoechst and Alexa555 predefined filter sets ...
-
bioRxiv - Biochemistry 2021Quote: ... bound to albumin (1:1 molar ratio) or 0.1 μM [1-14C]oleic acid (2 μCi/dish Perkin Elmer) bound to albumin (1:1 molar ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... ~2 nM [α-32P]-ATP (PerkinElmer) and an indicated content of ATP in 50 mM Tris-Cl (pH 6.8 ...
-
bioRxiv - Biochemistry 2021Quote: ... myo-[2-3H]inositol (NET114A001MC, PerkinElmer), UDP-[6-3H]GlcNAc (ART 1136 ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 nM of hNatD was mixed with 2 μM of radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences), 20 μM of the peptide ...
-
bioRxiv - Bioengineering 2024Quote: ... was injected subcutaneously (Figure 2) or intraperitoneally (Figure 4) into mice and bioluminescence imaging was performed using IVIS Lumina series III (PerkinElmer). During the measurement ...