Labshake search
Citations for PerkinElmer :
551 - 600 of 696 citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Huh-7 and Calu-3 cells were seeded in 96-well plate 96-CellCarrierUltra plates (Perkin Elmer, Hamburg, Germany), treated with ARN726 30 μM or GW6471 1μM and infected with SARS-CoV-2 1 MOI and 0.1 MOI respectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... we used THP-1 cells (4×105 cells/ml) adhered in an optical 96-well plate (PerkinElmer) with 50 ng/ml phorbol 12-myristate 13-acetate (PMA ...
-
bioRxiv - Cell Biology 2020Quote: ... 300 μl of each supernatant were mixed with 4 ml of Ultima Gold liquid scintillation cocktail (PerkinElmer) and run on a Hidex SL300 counter ...
-
bioRxiv - Plant Biology 2023Quote: ... The same seeds were transferred into weighing cup and weighed with an AD-4 Autobalance (PerkinElmer, Inc.). Single seed weight was subsequently determined by dividing the total weight by the number of seeds.
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Neuroscience 2021Quote: ... The signal of CB1 receptor hybridization was revealed by a TSA reaction using cyanine 3 (Cy3)-labeled tyramide (1:100 for 10 minutes, NEL744001KT PerkinElmer). After several washes ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was performed using the either the TSA Cyanine 3 Plus or the TSA Plus Fluorescein Evaluation Kits (Perkin Elmer).
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Microbiology 2022Quote: ... 48 hpi liver-stage cultures were washed with PBS and lysed in Nano-Glo Luciferase Assay buffer containing Nano-Glo Luciferase Assay substrate diluted 1:200 and luminescence was measured after 3 minutes on an IVIS Specturum CT (PerkinElmer). To monitor merosome detachment at 65 hpi ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Cell Biology 2022Quote: ... Hybridization signals were detected by a chromogenic reaction using red chromogen dilution 1:3000 (PerkinElmer TSA Plus Cyanine 3 System). RNA-staining signal was identified as red punctate dots and clusters ...
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Cell Biology 2024Quote: ... Fresh mouse cardiac biopsies (1 biopsy ∼1-3 mg/well) were distributed in a 96-well white microplate (OptiPlate-96; PerkinElmer) and incubated or not (basal ...
-
bioRxiv - Cell Biology 2024Quote: The glucose uptake was determined by seeding hBMSCs (passage 3) in a 96-well black/clear bottom plate (Perkin Elmer) at a density of 6,000 cells/well (6 wells/group) ...
-
bioRxiv - Cell Biology 2020Quote: ... and all qualitative imaging of Kif19 plasmids were conducted on a 4-D spinning-disk confocal microscope (PerkinElmer) with 60x (1.4 NA ...
-
bioRxiv - Neuroscience 2020Quote: ... TR-FRET measurements were routinely performed following overnight incubation at 4°C using an EnVision Reader (Perkin Elmer). Values were collected as the background subtracted ratio between fluorescence emission at 665 nm and 615 nm where the background signal corresponds to the ratio (665/615 ...
-
bioRxiv - Neuroscience 2021Quote: ... the free-floating sections were incubated overnight at 4°C with Streptavidin-Texas Red (1:400, NEL721001EA PerkinElmer). Finally ...
-
bioRxiv - Microbiology 2021Quote: KN99α was grown as described above in MM supplemented with 2 μCi/ml 3H-NE and 1.0 mM unlabeled NE or a mixture of 1.0 mM unlabeled NE and DA or with 4 μCi/mL (0.0001 mM) Dihydroxyphenylethylamine 3,4-[Ring-2,5,6-3H] (3H-DA, Perkin Elmer NET673250UC) and 1.0 mM unlabeled DA or 1.0 mM unlabeled NE and DA for 10 d at 30°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 4 µl of suspension was carefully distributed in the centre of an optical-bottom 96-well (PerkinElmer) for immunofluorescence experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Live imaging was done 4-8h later using a spinning disk confocal microscope (Perkin Elmer Ultra View ERS) equipped with a heating chamber (37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... filters were placed into scintillation vials with 4 mL Emulsifier-safe liquid scintillation fluid (Perkin Elmer, Waltham, MA) and analyzed using a liquid scintillation counter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were fixed in 4% PFA and imaged with the Opera Phenix High Content Screening System (Perkin Elmer), acquiring at least 10 images per well ...
-
bioRxiv - Cell Biology 2023Quote: ... the rabbit reticulocyte lysate master mix was supplemented with EasyTag L-35-Methionine (4% final reaction volume; PerkinElmer). Canine rough pancreatic microsomes (cRMs ...
-
bioRxiv - Immunology 2022Quote: ... Prior to the immunization all mice were anesthetized by isoflurane inhalation with RAS-4 Rodent Anesthesia System (PerkinElmer). Mice were euthanized on day 28 for terminal blood collection and spleens were harvested for cellular assays ...
-
bioRxiv - Plant Biology 2022Quote: ... dissolved in 0.1% nitric acid and 4 mL Optima Gold XR scintillant (Perkin Elmer, Glen Waverley, VIC, Australia) was added prior to counting for two minutes using a Liquid Scintillation Counter (LS6500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the extent of lung metastasis was measured every 3 days for 12 days using non-invasive imaging with IVIS Lumina III (Perkin Elmer). In brief ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both supernatant and lysate were moved to separate counting vials and mixed with 3 mL scintillation fluid (Ultima Gold #6013321, Perkin Elmer). 14C levels were measured in each sample using a Packard Liquid Scintillation Analyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was transferred to a tube and the protein-bound [α-32P]dCTP was quantified in a Beckman Coulter LS 6500 Liquid Scintillation Counter using OptiPhase HiSafe 3 (PerkinElmer) as solvent.
-
bioRxiv - Bioengineering 2021Quote: ... Mice were administered 3.3 mg D-Luciferin in the morning of day 3 and luminescence was recorded after 10 minutes by an In Vivo Imaging System (IVIS, Perkin Elmer) followed by i.v ...
-
bioRxiv - Neuroscience 2020Quote: ... was used as a secondary fluorophore for C1 probes (Gtpbp2, Slc7a1, Chac1) and TSA® Plus Cyanine 3 (PerkinElmer, 1:2,000) was used as a secondary fluorophore for C2 probes (Gtpbp1 ...
-
bioRxiv - Microbiology 2022Quote: ... The bound calcofluor was measured at excitation (λEx) 350 nm and emission (λEm) of 475 nm with VICTOR 3 1420 Multilabel Counter (PerkinElmer, USA).
-
bioRxiv - Microbiology 2022Quote: ... Animals were anaesthetized using an oxygen-filled induction chamber with 3% isoflurane and bioluminescence was measured using the in vivo imaging system IVIS (IVIS Spectrum Imaging System, Perkin Elmer). Mice were whole-body imaged in dorsal position and the signal intensity was obtained from luciferase expressed in T ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated at restrictive temperature (37°C) for 3 h and finally transfer to 384-well CellCarrier plates (PerkinElmer, 6007550) for imaging on an Opera QEHS high-content screening microscope (PerkinElmer) ...