Labshake search
Citations for PerkinElmer :
551 - 600 of 1320 citations for 1 4 Dichloro 2 5 bis dichloromethyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Emission intensity was recorded for 5 min using 460 nm and 530 nm filters on the EnVision or Victor X Light plate reader (PerkinElmer). Next ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed with the DNA absorption solution (for one sample: 50 uL 5 M NaCl, 15 ul magnetic beads (GMG-252-A-100mL – PerkinElmer), 250 uL 7.8 M guanidium chloride ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.05□μl of 5□mM stock compounds in DMSO were dispensed into assay microplates with a Janus 384 MDT NanoHead (PerkinElmer). Final concentration of the screening compounds in the assay was 16LμM ...
-
bioRxiv - Neuroscience 2023Quote: ... Live cell imaging was performed at 37°C in 5% CO2 for 24 hours using the Opera Phenix High Content Screening System (PerkinElmer). Acquired images were analyzed by using the Harmony software (PerkinElmer).
-
bioRxiv - Cell Biology 2024Quote: ... Tem1 (3.3 µM final concentration) was mixed with GTP (33 µM final) supplemented with 5 µCi [α-32P]-GTP (PerkinElmer) in the reaction buffer (20 mM HEPES pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Filters with the bound radioligand were transferred to vials containing 5 mL of Ultima Gold cocktail (PerkinElmer, Boston, MA, USA) and measured with a Packard Tri-Carb 2200CA liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Microtubes were then centrifuged at 1000g for 5 min and radiolabeled lipids were counted in the upper phase with a Tri-Carb 4910TR liquid scintillation counter (PerkinElmer). Results were normalized to total protein content and expressed in comparison to control cells.
-
bioRxiv - Systems Biology 2024Quote: ... They were then incubated with 0.5 ml of uptake solution containing [3H]glutamine (5 μCi/ml; Perkin Elmer, NET 55100) in either the presence ...
-
bioRxiv - Immunology 2024Quote: ... diluted 1:40 in assay diluent 5 and then IL-1β levels were measured using the Human IL- 1β HTRF kit (Cisbio – PerkinElmer), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The bacterial mCherry signal was measured on day 0 and day 5 post infection on an Envision plate reader (PerkinElmer). Oleate was maintained throughout the experiment in the rescue assay conditions.
-
bioRxiv - Immunology 2024Quote: ... of luciferase activity in each well was measured within 5 min after the addition of substrate using a Victor X4 plate reader (PerkinElmer). After subtracting background luciferase activity in uninfected cells ...
-
bioRxiv - Immunology 2024Quote: ... Fluoforte® fluorescence (excitation 490 nM/emission 525 nM) was quantified at time 0 (baseline) and after 5 minutes on an Envision plate reader (PerkinElmer). Normalized relative fluorescence units (ΔRFU ...
-
bioRxiv - Cancer Biology 2024Quote: ... Microtubes were centrifuged at 1000g for 5 min and radiolabeled lipids were counted in the upper phase with a Tri-Carb 4910TR liquid scintillation counter (PerkinElmer). Results were normalized to cell number as described for oxygen consumption.
-
bioRxiv - Genetics 2024Quote: ... Plates were incubated on a plate rocker for 5 min and luminescence read using a 400 to 700-nm filter equipped to an EnVision Plate Reader (PerkinElmer).
-
bioRxiv - Biophysics 2024Quote: ... 750 µl of lysed cells) were transferred to a scintillation vial with 5 ml of scintillation cocktail (Perkin Elmer, 6013327). Radioactivity was measured with a liquid scintillation analyzer (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metastatic outgrowth was longitudinally followed in vivo by intraperitoneal injection of luciferin (5 μg/kg) and imaging with IVIS Lumina III (PerkinElmer) (Garcia-Leon et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were anesthetized (2 % isofluorane gas in O2) and luminescence was recorded (IVIS Spectrum, Perkin Elmer, Waltham, MA). Images were analyzed with Living Image Software (Caliper LifeSciences).
-
bioRxiv - Plant Biology 2020Quote: ... N was quantified in approximately 2 mg subsamples using a CHN elemental analyzer (EA2400, PerkinElmer, Waltham, MA, USA). For phosphorus content ...
-
bioRxiv - Molecular Biology 2020Quote: ... In brief, using a rabbit antimelatonin antiserum (PF1288; P.A.R.I.S., Paris, France) and 2-Iodomelatonin (NEX236050UC; PerkinElmer, Boston, Massachusetts) as tracer RIA was performed ...
-
bioRxiv - Microbiology 2024Quote: ... 200 μl of each fraction was added to 2 ml of Ultima Gold liquid scintillation cocktail (Perkin Elmer), and the radioactivity was measured by a LS-6500 scintillation counter (Beckman) ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed twice for 2 minutes with wash buffer and incubated in Opal 520 (Perkin Elmer FP1487A) for 30 minutes at 40°C ...
-
bioRxiv - Biophysics 2022Quote: ... and incubated at 40 C for 2 h before counting with a MicroBeta scintillation top counter (Perkin Elmer).
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed twice for 2 minutes with wash buffer and incubated in Opal 520 (Perkin Elmer FP1487A) or vivid 520 (ACDbio 323271 ...
-
bioRxiv - Biochemistry 2023Quote: ... the beads were suspended in 25 µl of cytoplasmic buffer containing 2 µCi of 3H-labeled SAM (PerkinElmer) and incubated overnight at 32 °C without shaking ...
-
bioRxiv - Molecular Biology 2024Quote: ... cAMP- dependent luminescence was then measured at 2-min intervals using a PerkinElmer Envision 2104 plate reader (PerkinElmer), as described [24] ...
-
bioRxiv - Physiology 2020Quote: ... TSA® Plus fluorophore for channel 1 (fluorescein, PerkinElmer; 1:1000; 30 min), HRP blocker (15 min) ...
-
bioRxiv - Neuroscience 2024Quote: ... Opal570 (1:500) and Opal650 (1:1500) using the Opal 7 Kit (PerkinElmer).
-
bioRxiv - Physiology 2020Quote: ... Progesterone was extracted with ethyl ether after overnight equilibration (4°C) of the plasma with 1500 dpm of tritiated progesterone (Perkin Elmer, Rodgau, Ermany). Separation of the organic and aqueous phase was conducted similar to the procedure described for the other hormones ...
-
bioRxiv - Biochemistry 2021Quote: ... coli and all constructs were adjusted to approximately 4 μM concentration in cell lysate soluble fractions using a microcapillary electrophoretic system (Caliper; PerkinElmer, Waltham, MA, USA) and frozen in 96-well plates.
-
bioRxiv - Microbiology 2020Quote: ... the membranes were again washed three times for 5 min with TBS-T20 and the blots developed with Western lightning solution (Perkin Elmer) with a Fuji LAS-4000 imager (GE Healthcare).
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide probes (listed in Supplementary Table S2) were 5′ 32P-end labeled with 0.3 mCi of γ-32P ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Biophysics 2021Quote: ... Validation assays for 5-HT5AR-Gi1 expression were performed as described above using 10nM [3H]-LSD (82.4 Ci/mmol, PerkinElmer, Waltham, MA).
-
bioRxiv - Cancer Biology 2020Quote: ... Probes were prepared by random priming of corresponding PCR products (5’ and GFP templates) in the presence of [αP32]CTP (PerkinElmer BLU513H100UC). Unincorporated nucleotides were removed using a Sephadex G-50 column (GE Healthcare 28-9034-08) ...
-
bioRxiv - Neuroscience 2020Quote: ... the solvent was evaporated under N2 flow and resuspended with 500 mL of chloroform/methanol (2:1v/ v) and half the suspension was placed separately into vials with 5 mL of scintillation solution (Ultima Gold XR, Perkin Elmer). Levels of radioactivity were measured on the Liquid Scintillation Analyzer ...