Labshake search
Citations for PerkinElmer :
501 - 550 of 616 citations for 2 Trimethylsilyl Furo 3 2 B Pyridine 6 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... air-dried and then added to 3 mL of scintillation cocktail (Ultima Gold™; PerkinElmer, Waltham, MA, USA). Incorporated P33 in AMARA peptide was quantified using a liquid scintillation counter (Beckman ...
-
bioRxiv - Cancer Biology 2020Quote: ... plates were equilibrated to ambient temperature and washed 3 times (300 μL/well) with DELFIA Wash buffer (PerkinElmer). The plates were blocked for non-specific binding with 3% BSA (200 μL/well ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 mL of the hexane layer was added to 10 mL UltimaGold liquid scintillation cocktail (PerkinElmer, Waltham, USA) and measured on a TriCarb 2800TR liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were further processed according to the instructions in the TSA Plus Cyanine 3 kit (Perkin Elmer, NEL744001KT) to visualize the biotin conjugated secondary antibody bound to anti-S100a4 primary antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were anesthetized (3% isoflurane gas in O2) and luminescence was recorded (IVIS Spectrum, Perkin Elmer, Waltham, MA). Images were analyzed with Living Image Software (Caliper Life Sciences).
-
bioRxiv - Pathology 2021Quote: – For palmitate oxidation assay: Cells were preincubated for 3 hours with 14Cpalmitate (1uCi/mL; Perkin Elmer, Boston MA) and non labeled (cold ...
-
bioRxiv - Cancer Biology 2020Quote: ... Absorbance was recorded at OD560/OD590 nm with a Multifunctional Reader VICTOR X 3 (PerkinElmer, Waltham, MA, USA).
-
bioRxiv - Neuroscience 2021Quote: ... Sections were further processed according to the instructions in the TSA Plus Cyanine 3 kit (Perkin Elmer, NEL744001KT) in order to visualize the biotin conjugated secondary antibody bound to anti-S100a4 primary antibody ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Immunology 2024Quote: ... the infected mice were injected with 3 milligrams (diluted in 200 μl of PBS) of D-luciferin (PerkinElmer) substrate ...
-
bioRxiv - Systems Biology 2023Quote: ... Supernatant (70 µL) was collected and combined with 3 mL liquid scintillation cocktail (Perkin Elmer, Massachusetts, USA: 6013321) to allow the measurement of 3H with a Tri-Carb 2810TR Liquid Scintillation Counter (Perkin Elmer ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl of each sample was pipetted as triplicates on a 96-well plate (CulturPlate, 6005680, Perkin Elmer), and Passive Lysis Buffer was used as blank solution ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mL of scintillation liquid was added before quantification using Tri-Carb 5110TR Liquid Scintillation Counter (Perkin Elmer). Each oocyte was handled as a unique experiment and each datapoint represents 3-5 oocytes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Strains were grown for 3-5hs and OD were measured by the Enspire Multimodal Plate Reader (Perkin Elmer) before adding AMP ...
-
bioRxiv - Molecular Biology 2021Quote: ... with or without EcoRI hairpin oligo or NAD+ in histone methyltransferase buffer and 6 µM of radiolabeled [3H] AdoMet (Perkin Elmer Life Science # NET155V001MC). Recombinant human histone H4 (New England Biolabs # M2504S ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fluorescence was measured (excitation, 530 nm; emission, 595 nm) by a Victor 3 V 1420 microplate reader (Perkin Elmer).
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescence (λex = 525 nm; λem = 590 nm) was measured 3 h later in an Enspire Plate Reader (Perkin Elmer). For Nalm6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Oocytes were lysed with 1M NaOH and 1%SDS before the addition of 3 mL scintillant (Optiphase HisSafe, PerkinElmer), and l-[3H]glutamate transport was measured using a MicroBeta TriLux scintillation counter (PerkinElmer).
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were washed 3 times in PBS and incubated with tyramide Cy3 1:150 in amplification buffer (Perkin Elmer) for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Cell Biology 2020Quote: Fully differentiated C2C12 MS2-CAS myotubes were starved in serum-and glucose-free DMEM for 2 hrs before a 3-hr incubation in low-glucose DMEM/fatty acid-free BSA 0.2% supplemented with radiolabeled glucose (Glucose, D-[3-3H]; 1 μCi/ml; PerkinElmer). Then ...
-
bioRxiv - Physiology 2021Quote: ... where whole-body glucose flux was traced by infusion of 0.05 μCi/min D-[3-3H]-glucose (Perkin Elmer), after a priming 5 μCi bolus for 1 minute ...
-
bioRxiv - Physiology 2020Quote: ... The fluorescence signal was developed with tyramide signal amplification (TSA) Plus Cyanine 3 System kit (PerkinElmer, Waltham, Massachusetts, USA) as described previously (Tulke et al. ...
-
bioRxiv - Immunology 2021Quote: ... plasma solution at a rate of 0.18 ml/h for 90 min in parallel with a primed-continuous tracer D-[3-3H]-Glucose infusion (PerkinElmer, Waltham ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... [14C]-tetraethylammonium specific activity= 3.5 mCi/mmol) and [3H]-estrone 3-sulfate specific activity= 49.19 Ci/mmol) were purchased from Perkin Elmer. [3H]-phenylalanine (specific activity= 100 Ci/mmol) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were then rinsed in TBST 3 times and treated with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA). Membranes were exposed to GE Healthcare Hyperfilm ECL (28906839 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dehydrated coverslips were overlaid with 0.3 μg/ml TAMRA–OO-(CCCTAA)3 or 0.3 μg/mL Alexa 488–OO-(CCCTAA)3 telomeric PNA probe (Panagene) in PNA hybridization solution (70% deionized formamide, 0.25% (v/v) NEN blocking reagent (PerkinElmer), 10 mM Tris–HCl ...
-
bioRxiv - Microbiology 2024Quote: ... Zn2+ and Mn2+ amounts were calculated from standard curves made with Pure Plus Multi-Element Calibration Standard 3 (0.5-100ppb, PerkinElmer). Metals amounts detected in the 30% HNO3 blank were subtracted from all samples ...
-
bioRxiv - Molecular Biology 2024Quote: Mice were deprived of food for 3 h before intravenous injection of L-[4,5-3H(N)]leucine (NET1166, PerkinElmer) at a dose of 1 μCi/g ...
-
bioRxiv - Plant Biology 2024Quote: ... and the reactions were initiated by the addition of 3 μL of 52.6 mCi/mmol S-[methyl-14C]adenosyl-L-methionine (PerkinElmer). The reaction was overlaid with 1 mL of pentane and incubated 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... whole blood activity and plasma activity after centrifugation were measured in a gamma-counter (Wizard2, 3”; Perkin Elmer, USA). The whole blood curve was linearly interpolated and resampled to match the time points of the reconstructed fPET frames ...
-
bioRxiv - Microbiology 2024Quote: Huh-7 and Calu-3 cells were seeded in 96-well plate 96-CellCarrierUltra plates (Perkin Elmer, Hamburg, Germany), treated with ARN726 30 μM or GW6471 1μM and infected with SARS-CoV-2 1 MOI and 0.1 MOI respectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The signal of CB1 receptor hybridization was revealed by a TSA reaction using cyanine 3 (Cy3)-labeled tyramide (1:100 for 10 minutes, NEL744001KT PerkinElmer). After several washes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was performed using the either the TSA Cyanine 3 Plus or the TSA Plus Fluorescein Evaluation Kits (Perkin Elmer).
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...