Labshake search
Citations for PerkinElmer :
451 - 500 of 1229 citations for Ethyl 2 pyrrolidin 2 yl 2 3 dihydro 1 3 thiazole 4 carboxylate hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Luciferase activity was monitored weekly beginning 3 weeks post tumor initiation using the IVIS Lumina III (PerkinElmer).
-
bioRxiv - Cancer Biology 2023Quote: ... Imaging was performed using the Vectra 3 multispectral slide scanner in conjunction with Vectra 3.3 and Phenochart 1.0.4 software (PerkinElmer). Images were unmixed in inForm 2.2.0 and a selection of 15 representative original multi-spectral images was used to train the single-cell separation algorithm in HALO™ Image Analysis software (Indica Labs ...
-
bioRxiv - Immunology 2024Quote: ... The whole tissue section was scanned using our multiplex immunofluorescence (mIF) imaging platform (Vectra 3, Perkin Elmer). Phenochart was used to select all the regions of interest (ROI ...
-
bioRxiv - Microbiology 2021Quote: ... The fluorescence microscopy was performed using an UltraView RS-3 spinning disk confocal system (PerkinElmer Inc., United States), with a 491 nm 100 mW and a 561 nm 50 mW laser illumination under the control of MetaMorph Premier Software ...
-
bioRxiv - Molecular Biology 2020Quote: ... Detection reactions were incubated for 3 hours at 37°C on a VICTOR Nivo fluorescent plate reader (PerkinElmer) with fluorescence measurements taken every 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 10-minute TBST washes were performed followed by Western Lightning plus ECL Enhanced Chemiluminescence (Perkin Elmer, MA). Proteins were detected on X-ray film (Fuji ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Plant Biology 2021Quote: ... air-dried and then added to 3 mL of scintillation cocktail (Ultima Gold™; PerkinElmer, Waltham, MA, USA). Incorporated P33 in AMARA peptide was quantified using a liquid scintillation counter (Beckman ...
-
bioRxiv - Cancer Biology 2020Quote: ... plates were equilibrated to ambient temperature and washed 3 times (300 μL/well) with DELFIA Wash buffer (PerkinElmer). The plates were blocked for non-specific binding with 3% BSA (200 μL/well ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 mL of the hexane layer was added to 10 mL UltimaGold liquid scintillation cocktail (PerkinElmer, Waltham, USA) and measured on a TriCarb 2800TR liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were further processed according to the instructions in the TSA Plus Cyanine 3 kit (Perkin Elmer, NEL744001KT) to visualize the biotin conjugated secondary antibody bound to anti-S100a4 primary antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were anesthetized (3% isoflurane gas in O2) and luminescence was recorded (IVIS Spectrum, Perkin Elmer, Waltham, MA). Images were analyzed with Living Image Software (Caliper Life Sciences).
-
bioRxiv - Pathology 2021Quote: – For palmitate oxidation assay: Cells were preincubated for 3 hours with 14Cpalmitate (1uCi/mL; Perkin Elmer, Boston MA) and non labeled (cold ...
-
bioRxiv - Cancer Biology 2020Quote: ... Absorbance was recorded at OD560/OD590 nm with a Multifunctional Reader VICTOR X 3 (PerkinElmer, Waltham, MA, USA).
-
bioRxiv - Neuroscience 2021Quote: ... Sections were further processed according to the instructions in the TSA Plus Cyanine 3 kit (Perkin Elmer, NEL744001KT) in order to visualize the biotin conjugated secondary antibody bound to anti-S100a4 primary antibody ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Immunology 2024Quote: ... the infected mice were injected with 3 milligrams (diluted in 200 μl of PBS) of D-luciferin (PerkinElmer) substrate ...
-
bioRxiv - Systems Biology 2023Quote: ... Supernatant (70 µL) was collected and combined with 3 mL liquid scintillation cocktail (Perkin Elmer, Massachusetts, USA: 6013321) to allow the measurement of 3H with a Tri-Carb 2810TR Liquid Scintillation Counter (Perkin Elmer ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl of each sample was pipetted as triplicates on a 96-well plate (CulturPlate, 6005680, Perkin Elmer), and Passive Lysis Buffer was used as blank solution ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mL of scintillation liquid was added before quantification using Tri-Carb 5110TR Liquid Scintillation Counter (Perkin Elmer). Each oocyte was handled as a unique experiment and each datapoint represents 3-5 oocytes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Strains were grown for 3-5hs and OD were measured by the Enspire Multimodal Plate Reader (Perkin Elmer) before adding AMP ...
-
bioRxiv - Neuroscience 2024Quote: ... The various agents used were injected in a volume of 5 µl using an internal cannula (Invivo1, part #C313IS-5/SPC, Internal Canula, 28 gauge) connected to plastic tubing (Perkin Elmer, Cat#N0695476, 2-stop, I.D. 0.19 mm) and a 10 µl glass syringe (Hamilton ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fluorescence was measured (excitation, 530 nm; emission, 595 nm) by a Victor 3 V 1420 microplate reader (Perkin Elmer).
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescence (λex = 525 nm; λem = 590 nm) was measured 3 h later in an Enspire Plate Reader (Perkin Elmer). For Nalm6 ...
-
bioRxiv - Physiology 2021Quote: ... where whole-body glucose flux was traced by infusion of 0.05 μCi/min D-[3-3H]-glucose (Perkin Elmer), after a priming 5 μCi bolus for 1 minute ...
-
bioRxiv - Physiology 2020Quote: ... The fluorescence signal was developed with tyramide signal amplification (TSA) Plus Cyanine 3 System kit (PerkinElmer, Waltham, Massachusetts, USA) as described previously (Tulke et al. ...
-
bioRxiv - Immunology 2021Quote: ... plasma solution at a rate of 0.18 ml/h for 90 min in parallel with a primed-continuous tracer D-[3-3H]-Glucose infusion (PerkinElmer, Waltham ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... [14C]-tetraethylammonium specific activity= 3.5 mCi/mmol) and [3H]-estrone 3-sulfate specific activity= 49.19 Ci/mmol) were purchased from Perkin Elmer. [3H]-phenylalanine (specific activity= 100 Ci/mmol) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were then rinsed in TBST 3 times and treated with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA). Membranes were exposed to GE Healthcare Hyperfilm ECL (28906839 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dehydrated coverslips were overlaid with 0.3 μg/ml TAMRA–OO-(CCCTAA)3 or 0.3 μg/mL Alexa 488–OO-(CCCTAA)3 telomeric PNA probe (Panagene) in PNA hybridization solution (70% deionized formamide, 0.25% (v/v) NEN blocking reagent (PerkinElmer), 10 mM Tris–HCl ...
-
bioRxiv - Microbiology 2024Quote: ... Zn2+ and Mn2+ amounts were calculated from standard curves made with Pure Plus Multi-Element Calibration Standard 3 (0.5-100ppb, PerkinElmer). Metals amounts detected in the 30% HNO3 blank were subtracted from all samples ...
-
bioRxiv - Molecular Biology 2024Quote: Mice were deprived of food for 3 h before intravenous injection of L-[4,5-3H(N)]leucine (NET1166, PerkinElmer) at a dose of 1 μCi/g ...
-
bioRxiv - Plant Biology 2024Quote: ... and the reactions were initiated by the addition of 3 μL of 52.6 mCi/mmol S-[methyl-14C]adenosyl-L-methionine (PerkinElmer). The reaction was overlaid with 1 mL of pentane and incubated 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... whole blood activity and plasma activity after centrifugation were measured in a gamma-counter (Wizard2, 3”; Perkin Elmer, USA). The whole blood curve was linearly interpolated and resampled to match the time points of the reconstructed fPET frames ...
-
bioRxiv - Microbiology 2024Quote: Huh-7 and Calu-3 cells were seeded in 96-well plate 96-CellCarrierUltra plates (Perkin Elmer, Hamburg, Germany), treated with ARN726 30 μM or GW6471 1μM and infected with SARS-CoV-2 1 MOI and 0.1 MOI respectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was performed using the either the TSA Cyanine 3 Plus or the TSA Plus Fluorescein Evaluation Kits (Perkin Elmer).
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...