Labshake search
Citations for PerkinElmer :
451 - 500 of 729 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Immunology 2022Quote: ... Uptake was initiated by addition of 1 μCi [3H]2-DG (25-30 Ci/mmol, PerkinElmer, NET549) and 0.1 mM unlabeled 2-DG (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were loaded with 2 μCi/ml D-[2,3-3H]aspartate (Perkin Elmer, Waltham, MA, cat. #NET50100) in MEM +HIHS cell culture medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... Anesthetized (2% isoflurane vaporized in 1 L/min O2) dams were imaged (IVIS Lumina III, Perkin Elmer) with their ventral side facing the charge-coupled device camera (15 cm field of view ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µL of cell culture medium or standard solution was added to an Optiplate-384 microplate (PerkinElmer). 21µL of 10X mixture including acceptor beads and biotinylated antibody was then added to the wells with culture media or standard solution ...
-
bioRxiv - Cell Biology 2023Quote: ... cells on the SPA plate were suspended in 1 mL of DDW with 2% glusulase (PerkinElmer, #NEE154001EA) and digested with shaking at room temperature for 3 hr ...
-
bioRxiv - Cancer Biology 2021Quote: In vitro methyltransferase assays were performed using 30 ul reaction buffer (50 mM Tris-HCl pH 7.8, 50 mM KCl, 5 mM MgCl2) with 1 ul 3H-AdoMet (Perkin Elmer, specifific activity = 55-85 Ci/mMole,0.55 μCi/ul ...
-
bioRxiv - Cell Biology 2020Quote: ... and labeled for 5 min with with 1 μL per OD of cells of EXPRESS 35S Protein Labeling Mix (PerkinElmer) for 5 or 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... the plates containing infected macrophages were incubated at 37°C with 5% CO2 for 18 h in an Operetta High-Content Imaging System (PerkinElmer). During this 18 h incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were incubated for 5 minutes at 37°C with 55µCi/well of 35S-L-methionine and 35S-L-cysteine Promix (Perkin Elmer) in a minimal volume of culture medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cell motility was acquired using temperature (37°C) and CO2 (5%) controlled Operetta CLS High-Content Analysis System (PerkinElmer, HH16000000) (non-confocal ...
-
bioRxiv - Molecular Biology 2019Quote: ... was first deprotected and phenol-chloroform extracted and then 5’ end radiolabeled with [γ-32P] ATP (PerkinElmer, 6000 Ci/mmol) using T4 PNK (New England Biolab or Thermofisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cells were then incubated with 5 nM [3H]-E2 (specific activity 87.6 Ci/mmol; PerkinElmer Life Science, Waltham, MA) in the presence of increasing concentrations of 2’ ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Spectra were analysed using OPUS 6.5 software (Bruker) and compared with RMIT University’s spectral library of organic compounds generated using Spectrum 10 software (Perkin Elmer). Fingerprint spectra shown in Figure 4D were prepared using GraphPad Prism.
-
bioRxiv - Microbiology 2021Quote: ... 1.37 μg/mL of RBD and 5 μg/mL of Ecto) and incubated overnight in protein-binding 96-well plates (PerkinElmer). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... plates were centrifuged once more under same conditions mentioned above and 5 µL of each FRET antibody pair was added (2.5 nM final concentration for donor and 5 nM for acceptor, diluted in 1x Lance buffer, (Perkin Elmer)) ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Microbiology 2021Quote: ... and fluorescence at 355 nm excitation and 460 nm emission was monitored every 5 minutes for 50 minutes using an Envision plate reader (PerkinElmer). Rate of substrate cleavage was determined using linear regression of the raw data values obtained during the time course ...
-
bioRxiv - Neuroscience 2022Quote: ... Nifene or nicotine respectively for 5 min followed by addition of 2.5 nM [125I]-epibatidine ([125I]Epb) (2200 Ci/mmol; Perkin Elmer) and incubation for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Neuroscience 2019Quote: ... were transfected into the indicated cells (HEK293/17: 4×105/well; CHO: 2.5×104/well, BMVECs: 5×103/well) in 96-well plates (PerkinElmer, 6005680) in triplicate ...
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were grown for imaging using standard conditions and imaged in low fluorescence medium containing 5 µg/ml Dextran Alexa Fluor 647 on an Opera Phenix (PerkinElmer) automated system as described above.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Emission intensity was recorded for 5 min using 460 nm and 530 nm filters on the EnVision or Victor X Light plate reader (PerkinElmer). Next ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.05□μl of 5□mM stock compounds in DMSO were dispensed into assay microplates with a Janus 384 MDT NanoHead (PerkinElmer). Final concentration of the screening compounds in the assay was 16LμM ...
-
bioRxiv - Neuroscience 2023Quote: ... Live cell imaging was performed at 37°C in 5% CO2 for 24 hours using the Opera Phenix High Content Screening System (PerkinElmer). Acquired images were analyzed by using the Harmony software (PerkinElmer).
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed with the DNA absorption solution (for one sample: 50 uL 5 M NaCl, 15 ul magnetic beads (GMG-252-A-100mL – PerkinElmer), 250 uL 7.8 M guanidium chloride ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were anesthetized (2 % isofluorane gas in O2) and luminescence was recorded (IVIS Spectrum, Perkin Elmer, Waltham, MA). Images were analyzed with Living Image Software (Caliper LifeSciences).
-
bioRxiv - Plant Biology 2020Quote: ... N was quantified in approximately 2 mg subsamples using a CHN elemental analyzer (EA2400, PerkinElmer, Waltham, MA, USA). For phosphorus content ...
-
bioRxiv - Molecular Biology 2020Quote: ... In brief, using a rabbit antimelatonin antiserum (PF1288; P.A.R.I.S., Paris, France) and 2-Iodomelatonin (NEX236050UC; PerkinElmer, Boston, Massachusetts) as tracer RIA was performed ...