Labshake search
Citations for PerkinElmer :
451 - 500 of 1200 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... 25 and 30 mins after injection as kinetic analysis determined the peak luciferase activity at 20-25 mins post-injection (IVIS Spectrum imaging system, PerkinElmer). Images were analysed with Living Image software ...
-
bioRxiv - Cell Biology 2021Quote: ... The AlphaLISA™ assay was in 20 μL reactions (requiring only 2 μL cell culture media sample) in 384-well plate (6007290, PerkinElmer) following standard two-step no-wash protocol without any modifications ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The plates were shaken on an orbital shaker at 300 rpm for 20 min and then read on an Envision 2104 Multilabel reader (PerkinElmer). Experiments were repeated in triplicate and data was analyzed with Graphpad Prism version 8.00 ...
-
bioRxiv - Plant Biology 2019Quote: ... 20 μl samples of headspace were analysed for ethylene content using a gas chromatograph (GC, Perkin Elmer Clarus® 580) with a Carboxen 1010 PLOT 30 m × 0.53 mm capillary column and a flame ionisation detector (FID ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were shaken and incubated in darkness for 20 minutes and the luminescence value of each well was read by a luminometer (EnVision, PerkinElmer). Percent inhibition was calculated by subtracting the luminescence values of each experimental data point from the average minimum signal obtained from positive control values and dividing by the difference between the average maximum signal negative control and the positive control ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were then incubated for 18 h and harvested for luciferase activity quantified using Britelite Plus (Perkin Elmer; 20 µL) on a Synergy Neo plate reader (Biotek) ...
-
bioRxiv - Immunology 2019Quote: ... Five to 20 Z-stacked confocal images per well were acquired from randomized fields using Opera Phenix High Content Screening System (PerkinElmer) with a 63x objective ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was washed in PBS containing 0.1% Tween-20 and then exposed to developing solution (Western Lighting Chemiluminescence kit, Perkin Elmer) according to manufacturer’s guidelines ...
-
bioRxiv - Immunology 2021Quote: ... cell lysate was loaded onto a 96-well plate (Grenier-BioOne) and mixed with MICROSCINTTM-20 scintillation fluid (Perkin Elmer). Samples were then incubated at room temperature for 2 hours and incorporated radioactivity analyzed on a 1450 MicroBeta TriLux Microplate Scintillation and Luminescence counter (Perkin Elmer).
-
bioRxiv - Cancer Biology 2022Quote: ... 15 or 10-20% SDS-PAGE gels and proteins were transferred onto PVDF membranes (0.45 μm, Perkin Elmer, Waltham, MA) and blocked with 5% BSA/TBS-T for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The plate was incubated for 20 min at room temperature and read in a Victor X5 plate reader (Perkin Elmer), in luminescent mode ...
-
bioRxiv - Genomics 2022Quote: ... 20 µl of the lysate was transferred in duplicate in a well of an OptiPlate-96 HB (PerkinElmer, Waltham, MA) and 100 µl of Luciferase Assay Reagent II was added in each well ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein biosynthesis rates were determined by measuring the incorporation of radioactive methionine in auranofin-treated and untreated samples after protein precipitation with 20 % (w/v) trichloro acetic acid using a scintillation counter (Tri-Carb 2800TR, PerkinElmer). 55 µg of protein from pulse-labeled samples for analytical gels and 300 µg of protein from unlabeled samples for preparative gels were rehydrated into IPG strips (24 cm ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The plates were further incubated for 20 min at room temperature and counted using the Wallac TriLux Microbeta counter (PerkinElmer). The results were analysed using GraphPad Prism 9.1 ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...
-
bioRxiv - Cell Biology 2019Quote: ... eluted proteins were incubated overnight at 4 °C and measured with a microplate reader analyzer (EnVision, PerkinElmer). Excitation spectra were obtained collecting emission at 515 ± 15 nm ...
-
bioRxiv - Cell Biology 2020Quote: ... 300 μl of each supernatant were mixed with 4 ml of Ultima Gold liquid scintillation cocktail (PerkinElmer) and run on a Hidex SL300 counter ...
-
bioRxiv - Zoology 2019Quote: ... to which 4 mL of scintillation fluid (Emulsifier-Safe cocktail, Cat. No. 6013389, Perkin Elmer, Groningen, Netherlands) was added ...
-
bioRxiv - Plant Biology 2023Quote: ... The same seeds were transferred into weighing cup and weighed with an AD-4 Autobalance (PerkinElmer, Inc.). Single seed weight was subsequently determined by dividing the total weight by the number of seeds.
-
bioRxiv - Pathology 2023Quote: ... The signal of p-MLC2 was amplified by the Opal 4 color manual IHC kit (NEL810001KT, PerkinElmer). All pictures were taken with a Zeiss Axioplan 2 microscope ...
-
bioRxiv - Cell Biology 2019Quote: ... Acquisition was performed on at least 1000 cells per well (3 wells per condition) with 20X objective with Harmony Imaging Software 4.1 (Perkin Elmer). Image analysis was pursued using Colombus 2.5.0 software (Perkin Elmer ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Bioengineering 2019Quote: ... was performed at 24 and 72h (n=3) and cells were imaged using Operetta CLS high-content screening system (PerkinElmer) using 10x magnification and filters for calcein and EthD detection ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was performed using the either the TSA Cyanine 3 Plus or the TSA Plus Fluorescein Evaluation Kits (Perkin Elmer).
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Microbiology 2020Quote: ... Further 160μl of DNS solution was added in each well and incubated at 100°C for 20 min followed by reading at 570nm in multimode plate reader (Perkin Elmer). All the quantitative assays were done in triplicates and the activity was estimated using the standard graph of glucose.
-
bioRxiv - Developmental Biology 2021Quote: ... 10-20 gastruloids per condition were then transferred into a well of a flat-bottom CellCarrier-96 ultra plate (PerkinElmer, 6007008) and imaged on an Opera Phenix HCS system (PerkinElmer ...
-
bioRxiv - Biophysics 2019Quote: ... The plate was then incubated for 20-48 hours at 30°C in a Victor X3 multimode plate reader (Perkin Elmer). Every 10 minutes ...
-
bioRxiv - Developmental Biology 2019Quote: ... Confocal images of spindles and chromosomes in live oocytes were obtained with a 20/10 oil objective on a spinning disk confocal microscope (Perkin Elmer).
-
bioRxiv - Cell Biology 2019Quote: ... injected intraperitoneally with 150 mg/kg of D-Luciferin solution and imaged at 20 minutes post injection (for tumour monitoring) and 15 minutes post injection (for MSCs) using an IVIS Lumina (Perkin Elmer). Exposure times were optimised to ensure sufficient signal was obtained without saturation ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were then treated for 10 minutes with indicated compounds before addition of 20 μCi of 32P-ortho-phosphoric acid (Perkin Elmer). Cells were incubated for 1 hour with media containing drugs and 32P-ortho-phosphoric acid ...
-
bioRxiv - Cell Biology 2021Quote: ... The AlphaLISA® SureFire® Ultra™ assay was run in total volume 20 μL (using only 10 μL cell culture lysate sample) in 384 well plate (PerkinElmer, #6007290) following standard assay two step no-wash protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... For signal detection sections were incubated with the channel specific HRP for 20 min at 40 °C and incubated with the respective fluorophores (Perkin Elmer: Fluorescein ...
-
bioRxiv - Bioengineering 2019Quote: ... Collagen hydrogels were prepared as described with 20 μM Aβ and 250 nM HiLyte Aβ then pipetted into 0.8-mm deep hybridization chambers (PerkinElmer, Waltham, MA) on a borosilicate cover glass ...
-
bioRxiv - Bioengineering 2019Quote: ... Hydrogels were prepared as described with 20 μM Aβ and 250 nM HiLyte Aβ then pipetted into 0.8-mm deep hybridization chambers (PerkinElmer, Waltham, MA) on a borosilicate cover glass ...
-
bioRxiv - Biochemistry 2022Quote: ... was licensed at a final concentration of 7.5 ng/µl for 20 min at room temperature in HSS supplemented with trace amounts of [α-32P]dATP (Perkin Elmer). DNA replication was initiated by addition of two volumes of NPE mixture to one volume of licensing mixture ...