Labshake search
Citations for Qiagen :
1 - 50 of 5860 citations for rno mir 542 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Relative-fold changes were normalized comparing exosomal micro RNA reference gene miR-30c-5p using the primer hsa-miR-30c-5p miRCURY LNA miRNA PCR Assay (Qiagen 339306, gene globe ID YP00204783). Relative fold changes of miR223-3p of fro/fro mice were calculated to +/fro mice by using the formula ...
-
bioRxiv - Molecular Biology 2023Quote: ... mmu-miR-130b-5p (Qiagen, MSY0004583), has-miR-130b-3p (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... miR-329 pLNA (miRCURY LNA miRNA Power Inhibitor RNO-MIR-329-3P, Qiagen # 339130 YI04101481-DCA), miR-495 pLNA (miRCURY LNA miRNA Power Inhibitor HSA-MIR-495-3P ...
-
bioRxiv - Molecular Biology 2023Quote: ... and has-miR-130b-5p (Qiagen, MIMAT0004680) were transiently expressed to induce senescence-like phenotype ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Ant-has-miR-130b-5p (Qiagen, MIMAT0004680) were employed to inhibit the respective microRNAs ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: For SYBR Green and Taqman PCR Serial dilutions of known standards were made using synthetic miR-122 (syn has-miR-122-5p, 219600, Qiagen). The dilutions were prepared in triplicate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Ct values for hsa-miR-145-5p (Qiagen, YP00204483) were normalized to expression levels of hsa-miR-423-5p (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were co-transfected at DIV 19 with 10nM of a miR-499-5p or control pLNA inhibitor (miRCURY LNA miRNA-499-5p Power Inhibitor: miR-499-5p or Neg Control A, QIAGEN). After 72h of expression ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cDNA template was amplified using microRNA-specific miRCURY LNATM primers for mature miR-9-5p (YP00204513, Qiagen). qRT-PCR was performed as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... commercially obtained hsa-let-7a-5p or hsa-miR-205-5p miRCURY LNA miRNA Inhibitor (Qiagen, cat# YI04101776 and YI04101508 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Digoxigenin labeled miRCURY LNA probes (HSA-MIR-10B-5P, SCRAMBLE-MIR, miRCURY LNA U6, Qiagen) were diluted in hybridiziation buffer after a denaturation step at 90 °C and incubated on cells for 30 min (60 min tissue sections ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA™ PCR primer set (Qiagen). PCR amplification and detection were performed with the Applied Biosystems StepOnePlus Real-Time detector ...
-
bioRxiv - Molecular Biology 2019Quote: ... gambiae miR-276-5p miScript miRNA Mimic (100 ng, Qiagen) at a final concentration of 100 nm were co-transfected into Drosophila S2 cells using FuGENE HD transfection reagent (Promega) ...
-
bioRxiv - Genomics 2021Quote: ... The mmu-miR-122-5p miRCURY LNA probe (YD00615338, QIAGEN) was used to detect the dre-miR-122-5p mature form ...
-
bioRxiv - Molecular Biology 2019Quote: Quantification of miR-9-5p expression in kidney mice samples was performed using the miRCURY LNA RT Kit (Qiagen). Following RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... and miR-324 inhibitors (hsa-miR-324-5p and hsa-miR-324-3p miRCURY LNA miRNA Inhibitor) were obtained from QIAGEN. The sequences of synthetic siRNAs and miRNAs are listed in Supplementary Table S1.
-
bioRxiv - Molecular Biology 2023Quote: ... and transfected 24 hours later with 100 nM antisense oligonucleotide targeting miR-194-5p or miR-608 as control (miR-608 is not expressed in Hep G2 cells) (Exiqon, Qiagen) using Lipofectamine™ 3000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Expression levels of miR-142-5p were analyzed using miScript PCR System or miRCURY LNA SYBR Green PCR Kit (Qiagen). Specific primer pairs (miScript Primer Assay or miRCURY LNA miRNA PCR Assay ...
-
bioRxiv - Pathology 2020Quote: ... and the RT product was used for detection of miR-574-5p/3p and control RNA Snord68 using the miScript Primer Assay (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: miScript or miRCURY LNA Primer Assay was used to quantify the expression of miR-146a-5p (MS00003535 or YP00204688; Qiagen) in MIN6 cells or mouse pancreatic islets ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were normalized for the relative expression of the housekeeping miR103a-3p (hsa-miR-103a-3p, LNA™ PCR primer set, Qiagen), which showed no variability between analyzed groups.
-
bioRxiv - Cancer Biology 2020Quote: ... were normalized to expression levels of hsa-miR-423-5p (Qiagen, YP00205624) to determine fold change.
-
bioRxiv - Neuroscience 2024Quote: ... mice received a 0.5μM dose of a miR-505-5p mimic (Qiagen) or negative control combined with HiPerfect transfection reagent (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-hsa-miR-181a-5p miScript miRNA Inhibitor (20 nmol, Qiagen, cat# MIN0000256).
-
bioRxiv - Cancer Biology 2022Quote: ... 7.5nM of PD-L1-specific miR-455-5p TSB (339194; sequence: GTAGACTATGTGCCTTTGCTCAG; Qiagen) or scramble TSB (339194 ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV2 subgenomic viral RNA was quantified using primer probe sets as previously described (Wölfel et al., 2020) and Quantifast One-Step RT-PCR master mix (Qiagen) on a QuantStudio 3 or 5 instrument (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... The anti-sense miRCURY LNA miRNA detection probe dre-miR-146b-5p (YD00613622, QIAGEN) was used ...
-
bioRxiv - Neuroscience 2021Quote: ... double-digoxigenin locked nucleic acid probe (RNO-MIR-124-3P: CATTCACCGCGTGCCTTA, Tm: 84°C, 339111 YD00614870-BGC, miRCURY LNA™ miRNA Detection Probe, Qiagen) was used at a final concentration of 30 nM ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for genomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (Qiagen), in the Rotor-Gene Q (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for both genomic and subgenomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (QIAGEN), in the Rotor-Gene Q (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-qPCR for genomic viral RNA was performed using specific primer-probe sets and the QuantiFast Probe RT-PCR +ROX Vial Kit (QIAGEN), in the Rotor-Gene Q (QIAGEN ...
-
bioRxiv - Physiology 2020Quote: ... The custom LNA-modified miR-467a-5p antagonist and a control oligonucleotide were from Qiagen.
-
bioRxiv - Molecular Biology 2023Quote: ... A locked nucleic acid probe (mmu-miR-450b-5p miRCURY LNA miRNA Detection probe; Qiagen) was used to detect miR-450b while standard DNA oligonucleotide probes were used for other miRNAs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827, Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 µM each XBP1 specific primers and one-step RT-PCR (QIAGEN OneStep RT-PCR, 210212). The PCR products were analysed by 2% agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mir-103 (Qiagen primer Cat. No. YP00204306) was used as reference miRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers targeting miR-451a (QIAGEN, 3624799) and U6 snRNA (v2 ...
-
bioRxiv - Neuroscience 2024Quote: ... mHypoE-N46 cells were transfected with a miR-505-5p mimic (miRCURY LNA miRNA mimic, Qiagen) or negative control ...
-
bioRxiv - Cell Biology 2023Quote: ... Two different kits were used for this method depending on the primer set: Rotor-Gene SYBR® Green RT-PCR Kit (Qiagen, 204174) and SensiFAST™ SYBR® No-ROX One-Step Kit (BioLine ...
-
bioRxiv - Immunology 2020Quote: ... the miScript Universal Primer was used alongside miR specific miScript primer assays (miR-206 cat. no. MS00001869 and U6 cat. no. MS00033740; Qiagen).
-
bioRxiv - Genetics 2024Quote: ... and the following miRCURY LNA miRNA PCR primer sets (Qiagen, Hilden, Germany): dme-miR-210-3p (YP02104327) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The following oligos at the indicated concentration were used: 5nM of miR-455-5p mimic (MSY0003150, Qiagen) or recommended All Stars negative control siRNA (cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 nM of a miR-96-5p inhibitor or 100nM of a scrambled inhibitor (control) (Qiagen, UK).
-
bioRxiv - Pathology 2021Quote: ... using QuantiTect SYBR Green RT-PCR Kit and QuantiTect Primers (Qiagen). Three housekeeping gene mRNAs (GAPDH ...
-
bioRxiv - Molecular Biology 2021Quote: ... with miRCURY LNA™ primers (YP00203907 for U6; YP00205637 for miR-10b, YP00204339 for miR-125a) (QIAGEN). For mRNA analysis ...
-
bioRxiv - Developmental Biology 2022Quote: ... we treated rat AFSCs at 60% confluence with miR-17-5p and - 20a power inhibitors (25 μM) following the manufacturer’s protocol (Qiagen YI04100215-DDA ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification of a single product of the expected size by a primer pair was first confirmed by RT-PCR using Qiagen® One-Step RT-PCR kit (Qiagen) followed by agarose gel analysis of the amplified products ...
-
bioRxiv - Molecular Biology 2021Quote: ... The following primer sets from Qiagen were used ...
-
bioRxiv - Immunology 2020Quote: ... Mature miR-511-3p-specific primers were obtained from Qiagen and relative expression was normalised to U6 (RNU6-2 ...
-
bioRxiv - Genetics 2022Quote: ... 5 μl of the reverse transcribed products was amplified with the Vβ forward primers and Jβ reverse primer set pools (0.2 μM each) using a Multiplex PCR Kit (206143, QIAGEN, Germany). The following PCR program was used ...