Labshake search
Citations for Qiagen :
351 - 400 of 10000+ citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... only modified by using the QuantiTect Probe RT-PCR Kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized and amplified using OneStep RT-PCR Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... which was performed using a QuantiTect Probe RT-PCR Kit (Qiagen) on the LightCycler 480 system (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... and analysed using a One Step RT-PCR kit (Qiagen, #210210) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Overlapping amplicons were generated using the OneStep RT-PCR kit (Qiagen) with 5 μl of cDNA as a template ...
-
bioRxiv - Cell Biology 2023Quote: ... using the QuantiTect SYBR Green® RT-PCR kit (204243, Qiagen) as previously described [36] ...
-
bioRxiv - Cell Biology 2020Quote: ... miR 155 and miR 224 (Qiagen, HL, Germany) (with sequences as given in supplementary Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: ... 10μL volume PCR assays were conducted using Quantifast One Step RT-PCR kit (Qiagen, UK) on a ViiA7™ Real-Time PCR System (Applied bio-systems ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR gene expression analysis was performed with QuantiFast SYBR Green PCR kit (Qiagen) using a StepOnePlus (Applied Biosystem) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and analysed using a one-step RT-PCR (PCR with reverse transcription) kit from Qiagen, both using the standard protocol ...
-
bioRxiv - Cell Biology 2020Quote: Gene expression was quantified with a Rotor-gene Q real-time PCR cycler (Qiagen, Manchester, UK) using SYBR green or TaqMan chemistry ...
-
bioRxiv - Biophysics 2022Quote: ... and the melting curve was recorded on a Rotor-Gene Q real-time PCR cycler (Qiagen) using a temperature ramp from 28 to 98°C with 2°C/min rate ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reactions were carried out on a Rotor-Gene 6000 real-time PCR machine (Qiagen RGQ system). The following protocol was followed ...
-
bioRxiv - Molecular Biology 2020Quote: ... All reactions were performed in a Rotor-Gene Q real-time PCR thermocycler (QIAGEN, Hannover, Germany) using DNA extracted from the blood of known vertebrate samples as positive controls ...
-
bioRxiv - Neuroscience 2020Quote: ... Real-time PCR was performed on the thermal cycler Rotor-Gene Q (Qiagen, Venlo, Limburg, Netherlands) according to the following protocol ...
-
bioRxiv - Molecular Biology 2019Quote: Real-time quantitative PCR (qPCR) was performed on a Rotor-Gene Q 2plex HRM Platform (Qiagen) using SYBR Green as the detection dye ...
-
bioRxiv - Immunology 2021Quote: ... The cDNA was used on the real-time RT2 Profiler PCR Array (QIAGEN, Cat. no. CLAM38697) in combination with RT2 SYBR®Green qPCR Mastermix (Cat ...
-
bioRxiv - Immunology 2020Quote: ... Real-time PCR was performed on the thermal cycler Rotor-Gene Q (Qiagen, Venlo, Limburg, Netherlands) according to the following protocol ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR was realized in technical duplicates in the Rotor-Gene Q real-time PCR cycler (Qiagen). Two reactions with nuclease-free water without DNA were used as controls ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR gene expression analysis was performed using Rotor gene Q device and software (Qiagen) using SYBRGreen (4309155 ...
-
bioRxiv - Cell Biology 2020Quote: ... Real time qPCR was preformed using a QuantiNova SYBR Green kit (Qiagen; 208052) on an ABI StepOne thermocycler ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR reactions were performed in triplicate with a Qiagen Rotor-Gene Q 5Plex real-time cycler (Qiagen, Germantown, MD). Transcript levels of each gene were calculated relative to that of PP2A ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in 384 well plates on an Applied Biosystems 7900HT Fast Real-Time PCR system using the QuantiTect Virus Kit (Qiagen, Redwood City, CA) and SARS-CoV-CDC RUO primers and probes (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was performed using Real-time PCR for RT2 Profile PCR Array Mouse Cytokine and Chemokines using RT2 SYBR® Green Mastermixes (Qiagen). Using the RT2 qPCR Array Data Analysis spreadsheet ...
-
bioRxiv - Cell Biology 2021Quote: ... qRT-PCR was performed using the QuantiNova SYBR Green RT-PCR kit (Cat. No. 208154; Qiagen) and CT values were measured using the Rotor-Gene (Corbett ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed in technical replicates using QuantiFast SYBR Green RT-PCR Kit (Qiagen, # 204156) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... was used to extract RNA and the OneStep RT-PCR Kit (Qiagen) was used to synthesize cDNA ...
-
bioRxiv - Genomics 2020Quote: ... while the cDNA amplicons were made with OneStep RT-PCR kit (QIAGEN). Manufacturer protocols were followed for all experiments ...
-
bioRxiv - Cell Biology 2019Quote: ... in a single step using the Qiagen OneStep RT-PCR Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Amplifications were done using the OneStep RT-PCR kit (QIAgen, California, USA) with the following conditions ...
-
bioRxiv - Plant Biology 2020Quote: ... Amplification was carried out using a One-Step RT-PCR Kit (QIAGEN) and BIO-RAD T100 Thermal Cycler ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR was performed using the QuantiFast SYBR Green PCR kit (Qiagen). The PCR reaction was conducted on a Corbett Rotor-Gene 6000 (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... and the S gene was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (GENEWIZ) ...
-
bioRxiv - Immunology 2022Quote: ... and the S gene was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (GENEWIZ) ...
-
bioRxiv - Microbiology 2022Quote: ... All assays were adapted to the One-step RT-PCR Kit (Qiagen) reaction chemistry ...
-
bioRxiv - Genetics 2019Quote: ... RT-qPCR was performed with QuantiTect SYBR Green PCR Kit (QIAGEN, Germany) according to the manufacturer’s instruction by CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: RNA was quantified using the QuantiFast SYBR Green RT-PCR Kit (Qiagen). Primers used were for Esr1 (QuantiTect Primer Assays ...
-
bioRxiv - Immunology 2022Quote: ... and the S gene was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (Genewiz).
-
bioRxiv - Microbiology 2022Quote: ... then the template was amplified using the OneStep RT-PCR Kit (Qiagen) with the EILV-specific primers 5’-CGA CGA TGA CCG GAG AAG AG -3’ and reverse primer 5’-AAG ACT CGG TCT GCC TGC −3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... gcy-8 mRNA was detected using a OneStep RT-PCR kit (QIAGEN) from 3 ng of template RNA ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was then performed with QuantiTect SYBR Green PCR Kit (Qiagen) on a LightCycler 480 (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... A nested RT-PCR (QIAGEN hot start Taq master kit 1000 units) was then performed from 2 µL of previous amplicon for 15 min at 95°C then 35 cycles of amplification (30 sec at 94°C ...
-
bioRxiv - Genomics 2021Quote: ... and real-time qPCR on RotorGene (QIAGEN). Recovered DNA was concentrated ...
-
bioRxiv - Cell Biology 2020Quote: ... Absolute quantification by quantitative real-time PCR (qPCR) was performed with the Rotor-Gene Q thermocycler (Qiagen) and the QuantiNova SYBR Green PCR Kit ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR was performed using SYBR Green I fluorescence and Rotor-Gene Q cycler (Qiagen). Melting-curve analysis was done using Rotor-Gene Q series software version 2.1.0.
-
bioRxiv - Synthetic Biology 2022Quote: The fluorescence measurements in liquid were conducted using the real-time PCR cycler Rotor-Gene Q (Qiagen) considering the following protocol ...
-
bioRxiv - Biophysics 2022Quote: Melting curves of proteins were measured using the Rotor-Gene Q real-time PCR cycler (Qiagen, Germany). 25 μl samples with a protein concentration of approximately 0.5 mg/ml in a buffer containing 100 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was run using QuantiFast RT-PCR mix (Qiagen), probes targeting NiVM P gene (5’-ACATACAACTGGACCCARTGGTT-3’ and 5’-CACCCTCTCTCAGGGCTTGA-3’ ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR for individual miR-17∼92 members was performed using miRCURY LNA probes and miRCURY LNA SYBR Green PCR Kit (Qiagen).