Labshake search
Citations for Qiagen :
51 - 100 of 5919 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 µM each XBP1 specific primers and one-step RT-PCR (QIAGEN OneStep RT-PCR, 210212). The PCR products were analysed by 2% agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mir-103 (Qiagen primer Cat. No. YP00204306) was used as reference miRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers targeting miR-451a (QIAGEN, 3624799) and U6 snRNA (v2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Two different kits were used for this method depending on the primer set: Rotor-Gene SYBR® Green RT-PCR Kit (Qiagen, 204174) and SensiFAST™ SYBR® No-ROX One-Step Kit (BioLine ...
-
bioRxiv - Immunology 2020Quote: ... the miScript Universal Primer was used alongside miR specific miScript primer assays (miR-206 cat. no. MS00001869 and U6 cat. no. MS00033740; Qiagen).
-
bioRxiv - Immunology 2023Quote: ... 25 nM and 50 nM of synthetic hsa-miR-30b or control mimics (50 nM) (Qiagen). At 36 h post-transfection ...
-
bioRxiv - Genetics 2024Quote: ... and the following miRCURY LNA miRNA PCR primer sets (Qiagen, Hilden, Germany): dme-miR-210-3p (YP02104327) ...
-
bioRxiv - Neuroscience 2023Quote: ... were used to analyse the levels of PrPC in vitro after has-miR-519a-3p Mimic (Qiagen) transfection ...
-
bioRxiv - Pathology 2021Quote: ... using QuantiTect SYBR Green RT-PCR Kit and QuantiTect Primers (Qiagen). Three housekeeping gene mRNAs (GAPDH ...
-
bioRxiv - Developmental Biology 2019Quote: ... The TSB (5’-ATTATTGCACCCAGTGCC-3’: the miR-92a-3p target site is underlined) was designed and produced by Qiagen, with an additional scrambled TSB to act as a negative control (5’-TAACACGTGTATACGCCCA-3’) ...
-
bioRxiv - Molecular Biology 2021Quote: ... with miRCURY LNA™ primers (YP00203907 for U6; YP00205637 for miR-10b, YP00204339 for miR-125a) (QIAGEN). For mRNA analysis ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification of a single product of the expected size by a primer pair was first confirmed by RT-PCR using Qiagen® One-Step RT-PCR kit (Qiagen) followed by agarose gel analysis of the amplified products ...
-
bioRxiv - Molecular Biology 2021Quote: ... The following primer sets from Qiagen were used ...
-
bioRxiv - Immunology 2019Quote: ... SLE mice were retro-orbitally injected with 10 mg/kg of LNA-miR-22-3p (LNA-22) or scrambled control (LNA-Scr) (miRCURY LNA Inhibitor probe in-vivo, Qiagen) every 2 weeks beginning at 10-12 weeks of age ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Developmental Biology 2020Quote: Hsa-miR mimics (339173, miRCURY LNA miRNA Mimic) and inhibitors (339121, miRCURY LNA miRNA Inhibitors) were ordered from Qiagen, Hilden ...
-
bioRxiv - Genetics 2022Quote: ... 5 μl of the reverse transcribed products was amplified with the Vβ forward primers and Jβ reverse primer set pools (0.2 μM each) using a Multiplex PCR Kit (206143, QIAGEN, Germany). The following PCR program was used ...
-
bioRxiv - Genetics 2022Quote: ... Routine qPCR for miR detection and validation (see Supplementary Table 1 for miR sequences) was performed with the miScript PCR control set (catalog number 218380; Qiagen, Germany). The miScript™ miRNA PCR Array Human Serum & Plasma 384HC (Cat No ...
-
bioRxiv - Developmental Biology 2021Quote: ... using primers amplifying miR let7 (Qiagen, MS00005866; let-7g Qiagen, MS00010983).
-
bioRxiv - Developmental Biology 2021Quote: ... using primers amplifying miR let7 (Qiagen, MS00005866; let-7g Qiagen, MS00010983).
-
bioRxiv - Microbiology 2019Quote: ... Cementing PCR was performed using primer set 4438/441 and cleaned up using a QIAquick PCR Purification Kit (Qiagen) and transformed into DK1042.
-
bioRxiv - Neuroscience 2021Quote: ... Validated primer sets were obtained from Qiagen.
-
bioRxiv - Neuroscience 2024Quote: ... Validated QuantiTect primer sets obtained from (Qiagen) for IL-1α (QT00001127) ...
-
bioRxiv - Neuroscience 2021Quote: ... double-digoxigenin locked nucleic acid probe (RNO-MIR-124-3P: CATTCACCGCGTGCCTTA, Tm: 84°C, 339111 YD00614870-BGC, miRCURY LNA™ miRNA Detection Probe, Qiagen) was used at a final concentration of 30 nM ...
-
bioRxiv - Developmental Biology 2019Quote: We used a kit to detect mmu-miR-126-3p by in situ hybridization (catalog number 339111, Qiagen, Germantown, MD, USA). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... Specimens were incubated for 24 hours at room temperature in the presence of either an ASO antimiR targeting hsa-miR-134-5p (‘Ant-134’; Qiagen, Manchester ...
-
bioRxiv - Microbiology 2020Quote: ... The triplicate PCR amplicons from each sample-primer set combination were then pooled and purified using the QIAquick PCR purification kit (Qiagen), with a slightly altered protocol in which the final elution was performed on nuclease-free water pre-heated to 55°C and incubated for 5 min at 55° C before the final centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... All reactions were set up in triplicate using a One-Step RT-PCR kit (Qiagen, UK) as per the following run conditions ...
-
bioRxiv - Cancer Biology 2022Quote: ... according to manufacturer’s protocol (MiScript Primer assays and II RT kit for cDNA synthesis and MiScript SYBR Green PCR Kit for RT-qPCR, 218161, Qiagen) from which the recovery of cel-miR-39 spike-in control was confirmed.
-
bioRxiv - Molecular Biology 2023Quote: ... and −3p (Qiagen, MS00011123), we purchased commercial primers from Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... and quantitative RT-PCR was performed using SYBR-based primers (Supplemental Table 1) and RT SYBR Green qPCR Mastermix (Qiagen, #330509) on a CFX96 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... Predesigned primers for miR-126 and U6 were purchased from Qiagen (cat # 218300).
-
bioRxiv - Developmental Biology 2020Quote: ... RT-PCR was performed using OneStep RT-PCR Kit (QIAGEN) using the following primers ...
-
bioRxiv - Immunology 2023Quote: ... was performed in duplicates using predesigned primer sets (Quantitect Primer Assays, Qiagen, Germantown, MD). Relative mRNA expression between groups was analyzed by the delta-delta Ct method and normalized to housekeeping genes ...
-
bioRxiv - Cell Biology 2019Quote: ... qPCR was performed on a LightCycler 96 Real-Time PCR System using SYBR Green RT-PCR with the following Quantitec primers from Qiagen; IL-6 (QT0009887) ...
-
bioRxiv - Immunology 2023Quote: ... cDNAs were synthesized using High Capacity RNA-to-cDNA kit (ThermoFischer Scientific) and quantitative RT-PCR were carried out using specific primers (Table S2) and SYBR Green PCR Master Mix (Qiagen). PCR amplification of Gapdh was performed to control for sample loading and normalization between samples ...
-
bioRxiv - Microbiology 2020Quote: ... CDNA fragments were amplified with strain-specific primers using the one step RT-PCR kit (Qiagen). Sequencing was performed by Macrogen Europe ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... miRNA 22-3p (Qiagen #YP00204606). The expression levels of each miRNA target were normalized to calibrators U6-snRNA or GAPDH ...
-
bioRxiv - Cell Biology 2023Quote: ... miR-29b and miR-29c (Qiagen), using Lipofectamine 2000 transfection reagent (Invitrogen ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed using One Step RT-PCR kits (Qiagen) and a mixture of TRAV- ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-PCR was conducted using a OneStep RT-PCR kit (Qiagen) with the following primer pair ...
-
bioRxiv - Biochemistry 2020Quote: ... Reverse ttranscription (RT) for miRs was completed with 300 ng of total RNA using a miScript II RT Kit (Qiagen) per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed with 0.4 μM primers and using the QuantiTect SYBR Green PCR mix (Qiagen). Primer sequences are indicated in Table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Qiagen) in a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2019Quote: ... RT-PCR reactions were prepared using QuantiTect Probe RT-PCR Kit (Qiagen), with final concentrations of primers and probe used were 400 nM and 200 nM respectively ...
-
bioRxiv - Microbiology 2020Quote: ... rt-PCR was conducted with a OneStep RT-PCR kit (Qiagen Canada) by following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: RT-PCRs were performed with the One-step RT-PCR kit (QIAGEN) with SAO00187/SAO00188 (for 12S rRNA) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using the OneStep RT-PCR Kit (Qiagen, #210212), with the following conditions ...