Labshake search
Citations for Qiagen :
401 - 450 of 1778 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... with two 3 mm metal beads and ground into a fine powder with a TissueLyser II (Qiagen, Germany) at 30 Hz for 2 min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... genomic DNA was extracted from two batches of 50 adult females using the PureGene Core Kit A (Qiagen) and the two gDNA extracts were then pooled in equal proportion into a single sequencing library ...
-
bioRxiv - Genomics 2020Quote: ... The DNA-seq libraries were constructed from 500 ng of size selected DNA with the GeneRead DNA library I core kit (Qiagen, cat #180434) and GeneRead Adapter I set B (Qiagen ...
-
bioRxiv - Genomics 2021Quote: SmRNA-sequencing libraries were prepared from 50 to 150 ng of total RNA using the QIAseq miRNA Library Kit (Qiagen, Germantown, MD) as per the manufacturer’ s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: The QIAseq Ultra Low Input Library Kit was used to create DNA libraries for chromatin immunoprecipitation with the appropriate antibodies (QIAGEN, Hilden, Germany), as described [4] ...
-
bioRxiv - Cancer Biology 2021Quote: ... The amplified libraries were purified using MinElute columns (Qiagen) and sequenced on an Ilumina NextSeq 500 with 75 bp single-end reads ...
-
bioRxiv - Molecular Biology 2019Quote: ... or the QIAseq FX DNA Library Kit (QIAGEN 180475) and sequenced using Illumina SBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the QIAseq miRNA Library Kit (Qiagen, Valencia, CA). Briefly ...
-
bioRxiv - Genetics 2020Quote: ... Captured libraries were purified with MinElute spin columns (QIAGEN) and quantified with a D1000 High Sensitivity ScreenTape on an Agilent 2200 TapeStation.
-
bioRxiv - Microbiology 2022Quote: ... The cleaned library was then quantified using Qubit (Qiagen) (260/280) ...
-
bioRxiv - Genomics 2022Quote: ... Gene Read DNA Library I Core Kit (180434, Qiagen) was used for end-repair ...
-
bioRxiv - Genetics 2022Quote: ... Indexed libraries were purified using MinElute PCR Kit (Qiagen) and pooled according to molar estimates from Agilent TapeStation quantifications ...
-
bioRxiv - Cancer Biology 2019Quote: ... Post purification libraries were resuspended in EB buffer (Qiagen). The quality of cDNA traces was assessed by using a High Sensitivity DNA Kit in a Bioanalyzer instrument (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2023Quote: ... Final libraries were normalized with elution buffer (Qiagen, Germany) to a final concentration to 2 nM and pooled with an equal amount of each sample library ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were column purified (PCR MinElute, Qiagen, Manchester, UK), size selected by gel electrophoresis (550-650 bp ...
-
bioRxiv - Genomics 2023Quote: ... The library was purified using a MaxiPrep kit (Qiagen) and subcloned into a promoterless AttB pIRES:mCherry-BlastR18 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplified libraries were purified with PCR cleanup kit (Qiagen) and library quality was assessed on a Tapestation (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each library was cleaned with PCR purification kit (Qiagen) and eluted with 30 μL of RNase-free water ...
-
bioRxiv - Genetics 2023Quote: ... the libraries were purified using the MinElute system (Qiagen) and eluted in 25uL of 1 mM EDTA ...
-
bioRxiv - Immunology 2021Quote: cDNA synthesis was conducted by QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PerfeCTa SYBR Green FastMIX Low ROX (Quanta Bioscience) ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized using QuantiTect Reverse Transcription Kit (QIAGEN, 205311). qPCR and data analysis were performed as described previously (51) ...
-
bioRxiv - Genetics 2021Quote: ... cDNA synthesis was done with QuantiTect Reverse Transcription Kit (Qiagen) and qRT-PCR reactions were run with the SYBR Green reagent (Roche ...
-
bioRxiv - Genetics 2021Quote: ... cDNA synthesis was done with QuantiTect Reverse Transcription Kit (Qiagen). Splicing of unc-43 and unc-104 mRNAs was analyzed by running PCR products in agarose gels ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized with the Quantinova Reverse Transcription Kit (Qiagen). Quantitative PCR was performed in triplicate on a Step One Plus (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA was generated using the miScript II RT Kit (Qiagen). qPCR was performed using the miScript SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2019Quote: To synthesize first strand cDNA the Omniscript RT kit (Qiagen) was used ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was synthesized using the RT2 First Strand Kit (Qiagen), and transcriptional signaling was assessed using the rhesus macaque antiviral response RT2 Profiler PCR Array (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was purified using the MinElute PCR Purification Kit (Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Pathology 2019Quote: ... cDNA synthesis was done using RT2 First Strand Kit (Qiagen). The Qiagen iron metabolism RT2 profiler array was custom built (Cat ...
-
bioRxiv - Genetics 2020Quote: ... cDNAs were synthesized using the Omniscript Reverse transcriptase kit (Qiagen) in a 20 µl reaction mixture containing 1 µg total RNA ...
-
bioRxiv - Genetics 2019Quote: ... cDNA was purified using the MinElute Gel Extraction kit (QIAGEN). Libraries were sequenced using an Illumina NextSeq500 instrument.
-
bioRxiv - Genetics 2020Quote: ... cDNA was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... cDNA was generated with the RT2 First Strand Kit (Qiagen). qPCRs were performed using RT² Profiler™ PCR Array Mouse Skeletal Muscle ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was generated with the Quantitect Reverse transcription kit (Qiagen). Using the 2-ΔΔCt method ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA produced with the Omniscript RT Kit (Qiagen, #205111) with oligo dT primers ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen), followed by PCR using the primers ACACGCTTGGGAATGGACAC and CCATGGGAAGATGTTCTGGG and separation on 4% agarose ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA wassynthesized using the miScript II RT kit (Qiagen). Quantitative PCR was performed using the SensiFAST SYBR Hi-ROX kit (Bioline ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was transcribed using the QuantiTect reverse transcription kit (Qiagen) from all the samples and amplified by PCR using Q5 master mix (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen) and stored at −20°C for further use ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cDNAs were produced using QuantiTect reverse transcription kit (QIAGEN). qRT-PCR was performed using PowerUp SYBR Green Master Mix (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... purification and the biotinylated cDNA (in 40 μl EB, Qiagen) was bound to 15 μl 1x SSPE washed Dynabeads™ M-270 Streptavidin beads (Thermo ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was purified using the MinElute PCR purification kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... First strand cDNA was synthesized using Reverse Transcription Kit (Qiagen). Quantitative real time PCR was performed using SYBR Green and the following primers from Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... The cDNAs were amplified with Hot Start DNA Polymerase (QIAGEN). The PCR reaction protocol was ...
-
bioRxiv - Genetics 2022Quote: ... The cDNA was synthesized using miScript II RT kit (QIAGEN). qRT-PCR was performed by QuantiTect SYBR Green PCR using miRNA- specific primers provided as miScript Universal primer and miScript Primer assay (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA amplification using a OneStep RT-PCR Kit (Qiagen) and segment-specific primers (sequences available upon request) ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA was produced using the QuantiTect Whole Transcriptome Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Physiology 2019Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen). Reactions were carried out in triplicate with QuantiFast SYBR Green Master Mix (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was obtained using a QuantiTect reverse transcription kit (Qiagen). Samples were run in technical duplicates and quantification was obtained using the 2−ΔΔCT method and eef1a1a as a housekeeping gene ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA preparation was done using miScript II RT kit (Qiagen). The reaction condition was 37°C for 60 min and 95°C for 5 min ...