Labshake search
Citations for Qiagen :
251 - 300 of 2458 citations for Tumor Protein Translationally Controlled 1 TPT1 Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic DNA of microdissected tumor and matched normal samples (buffy coat) was extracted using the DNeasy Blood and Tissue Kit (Qiagen) and QIAamp DNA Blood Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted from a piece of fresh-frozen tissue from each patient tumor resection using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and fibroblasts (the latter two after resuspending cell pellets in 1x PBS)—except for blood from individuals whose tumors were profiled—was extracted with the MagAttract HMW DNA kit (Qiagen) per the manufacturer’s whole blood purification protocol ...
-
bioRxiv - Genetics 2023Quote: ... DNA from formalin-fixed paraffin-embedded (FFPE) tumor samples was isolated with the kit QIAamp DNA FFPE tissue Kit (Qiagen). All extractions were carried out following the manufacturers’ instructions.
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PDTO pellets and matched primary lung tumors (∼10mg tissue) were used for genomic DNA extraction using DNeasy Blood and Tissue kit (Qiagen). Genomic DNA was eluted with buffer AE (supplied in the kit ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA isolation from primary GBM tumors or patient-derived GBM cells was carried out using QIAamp DNA Micro kit (Qiagen). The Illumina Infinium MethylationEPIC kit was used to analyze the DNA methylation status at >850000 5’CpG islands per sample according to the manufactureŕs instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated and purified from both the livers of control and N-LKO mice or tumors of N-LKO mice using a RNA isolation Kit from Qiagen, followed by DNAse treatment to eliminate any genomic contamination using RNA Min Elute Cleanup from Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... bone marrow of transplanted tumor bearing CTR and VEGF-C mice was isolated and gDNA was purified using QIAmp DNA Mini Kit (Qiagen) as described ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was extracted from 363 cryopreserved biopsies of KS tumor and normal skin (termed normal adjacent tissue, NAT) using the DNeasy Blood & Tissue Kit (QIAGEN) and prepared for T-cell receptor β chain (TRB ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from cryopreserved KS tumor biopsies using the RNeasy Fibrous Tissue Mini Kit (QIAGEN, Venlo, The Netherlands), quantitated on a Qubit 3.0 Fluorometer (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... slides from 25 epidemic KS and 2 endemic KS tumor biopsies and 5 samples of uninvolved skin using the AllPrep DNA/RNA FFPE Kit (QIAGEN). Gene expression analysis was performed on RNA samples on the Nanostring platform (Nanostring Technologies ...
-
bioRxiv - Immunology 2022Quote: ... The cleaved protein was passed over a 1 mL Ni-NTA agarose (Qiagen) gravity column to remove TEV protease ...
-
bioRxiv - Molecular Biology 2023Quote: The eluted protein was mixed with 1 ml Strep-Tactin Superflow agarose (Qiagen) and incubated at 4 °C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse tetracycline-controlled transactivator flanked by AAVS1 homology arms 30 was transfected into the indicated cell line using Effectene (Qiagen) according to the manufacturer’s protocol with a pX330-based plasmid 28 expressing both sp-Cas9 and a guide RNA specific for the AAVS1 locus (GGGGCCACTAGGGACAGGAT) ...
-
bioRxiv - Plant Biology 2023Quote: The complete RNA was extracted from the plant samples (WT, ERF60-OX, and erf60 mutant) under controlled conditions utilizing the RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and with a mouse antibody against the His-tag (Tetra·His Antibody, QIAGEN-Cat. No.34670, 1:2,000) in blocking solution on a rocker ...
-
bioRxiv - Cancer Biology 2021Quote: ... an individual tumor biopsy was immersed in RNA later and the RNA further extracted using a RNeasy Mini Kit (Qiagen, Germany).
-
bioRxiv - Bioengineering 2020Quote: ... and the same amount of lysate from each tumor was used to extract total RNA with the RNeasy Mini Kit (Qiagen, 74104) followed by reverse transcription using the same amount of template RNA ...
-
bioRxiv - Cancer Biology 2020Quote: RNAs were extracted from tumor tissues or cancer cell lines then reverse transcribed using Kit from RNAeasy mini kit (Qiagen 74106) and Vazyme (R223-111 01) ...
-
bioRxiv - Cancer Biology 2022Quote: CAL27-MK2WT and CAL27-MK2KD cells cultured in normoxia/hypoxia and tumors resected from the xenografted mice were employed for isolation of total cellular RNA using the RNeasy Mini kit (Qiagen, Germany) following the manufacturer’s recommended protocol (sample details are provided in Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was isolated from cell lines or frozen tumor tissues using the RNeasy Mini Kit according to the manufacturer’s protocol (Qiagen, Hilden, Germany). RNA yield and purity were assessed using a Fragment Analyzer 5200 (Agilent technologies ...
-
bioRxiv - Cancer Biology 2019Quote: DNA was extracted from fresh frozen micro-dissected primary lung tumor tissues using the Qiagen DNeasy Blood and Tissue kit spin column procedure according to the manufacturer’s protocol (Qiagen, Valencia, CA). Isolated primary lung tumor DNAs were initially quantified using a DS-11 spectrophotometer (DeNovix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 SCID mT3-2D subcutaneous tumors and the mT3-2D cell line using a DNeasy Blood and Tissue Kit (Qiagen, #69504). Indexed ...
-
bioRxiv - Genetics 2020Quote: Approximately 50 mm3 of tumor tissue from each region was used for genomic DNA extraction using the QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Total RNA was isolated from a tumor-reactive T cell culture using a Qiagen RNeasy Micro kit (Qiagen GmbH, Hilden, Germany). 1μg total RNA was used for reverse transcription with the NEB Template Switching Reverse Transcriptase Enzyme Mix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was extracted from patient tissue samples and flash frozen mouse xenograft tumor samples (n = 4) using the RNeasy kit (Qiagen; #74104) and converted to cDNA using the qScript cDNA Synthesis kit (Quantabio ...
-
bioRxiv - Molecular Biology 2023Quote: ... the other half of tumor tissues were lysed using lysis buffer (0.1% Triton X-100) and a TissueLyser homogenizer (Qiagen, Hilden, Germany). DNA for PCR was isolated from 50 µl of tissue lysate using the Maxwell RSC tissue DNA Kit (Promega ...
-
bioRxiv - Genomics 2023Quote: ... tumor DNA was extracted following pathological review and macro-dissection of formalin-fixed paraffin-embedded (FFPE) tumor tissue using the Qiagen DNA FFPE kit (Qiagen GmbH). Tumor and matched WBC DNA were sheared to a target fragment size of 200bp and processed for WES as described previously (8) ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted from the paired primary-recurrent frozen tumor samples using the RNA Mini Kit according to the manufacturer’s protocol (Qiagen; Germantown, MD). Nucleic acid concentration and purity were assessed using a NanoDropTM 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: RNA was extracted and purified from flash frozen tumors/normal tissues and cells using a Qiagen RNeasy kit following the manufacturer’s instructions for fibrous tissue (Qiagen, Hilden, Germany). High quality RNA (RIN >7 ...
-
bioRxiv - Molecular Biology 2023Quote: Extracted normal and tumor regions were ground in liquid nitrogen and RNA extracted using the RNeasy RNA extraction kit (Qiagen 74104) then analyzed using a 2200 Tapestation Analyser (Agilent) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from FFPE tumor cores (n= 12 samples) using RNeasy FFPE kits according to the manufacturer’s protocol (QIAGEN, Germantown, MD). RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits ...
-
bioRxiv - Biochemistry 2022Quote: ... Membranes were blocked for 1 hour at room temperature either with a commercial blocking buffer (QIAGEN, anti RGS HIS6 HRP conjugate kit) or with 5% milk in 0.05% tween TBS buffer ...
-
bioRxiv - Biochemistry 2021Quote: Penta-His HRP conjugate was purchased from QIAGEN (Hilden, Germany). Anti-BepA (Narita et al. ...
-
bioRxiv - Biophysics 2019Quote: ... and probed with primary antibodies anti-5His monoclonal (1:1,000; QIAGEN), anti-Myc monoclonal (1:1,000 ...
-
bioRxiv - Immunology 2021Quote: ... Gene expression profiling of inflammatory cytokines and receptors of normal and KP-OVA tumor bearing lungs was performed by custom RT2 Profiler PCR Array (Qiagen, cat. 330221) following manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... Additional biopsy sections were collected from the same regions and at two distinct areas of the tumor were placed in Allprotect Tissue Reagent (Qiagen, Hilden, Germany) and stored at 4° C for DNA extraction and evaluated histopathologically ...
-
bioRxiv - Cancer Biology 2021Quote: ... For RNA isolation tumor tissue was lysed using Qiazol and total RNA was isolated using the miRNeasy Mini Kit (Qiagen, Cat.No# 74004) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA from cancer cells (cultured 48 hours in RPMI supplemented with 10% FBS) or primary tumors was extracted using an RNAeasy kit (Qiagen, Germantown, MD), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Lung tumour tissue was microdissected and isolated from FFPE tumor blocks and DNA was purified using the QIAamp kit (Qiagen; catalog #56404). Alternatively ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNAs from mouse tumors were extracted and purified using the RNeasy Mini Kit and RNase-free DNase Set (QIAGEN, Valencia, CA) following the protocol provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: ... and areas containing >30% tumor cells as determined by an expert pathologist were macrodissected and deparaffinated using Deparaffinization Solution (Qiagen, Hilden, Germany). DNA was extracted and purified with GeneRead DNA FFPE Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: Sorted tumor cells were resuspended in lysis buffer included as a part of the RNeasy® Micro Kit (#74004, Qiagen, Hilden, Germany). mRNA was then isolated and purified in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... The long genomic DNA was isolated from 5-10mg tumor core using Gentra Puregene Tissue Kit following the manufacturer’s instructions (Qiagen, Cat. No 158667). Briefly ...
-
bioRxiv - Pathology 2021Quote: ... was isolated from the tumor FFPE sections using miRNeasy FFPE kit (Qiagen, Cat No. 217504; miRNeasy FFPE Handbook Qiagen, HB-0374-005). Deparaffinization was performed with xylene as described in Appendix A ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated from HFC (n = 3) and LFC (n = 4) tumor samples using the RNeasy Plus Universal Mini Kit (QIAGEN, Valencia, CA) and RNA quality was confirmed using an Advanced Analytical Fragment Analyzer ...
-
bioRxiv - Cancer Biology 2021Quote: Snap frozen primary tumors were prepared for RNA isolation by TRIZOL digestion and subsequent homogenization using a TissueLyser II (Qiagen, Hilden, Germany) with a 5 mm stainless steel bead for 2 min at 30 Hz ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was extracted from the tumor specimens and the cultured cell lines using a QIAmp mini DNA isolation kit (Qiagen, cat # 51304). Sixteen loci were screened for regions of microsatellite instability with defined trinucleotide or tetranucleotide repeats within the chromosomes ...
-
bioRxiv - Cancer Biology 2022Quote: ... paraffin-embedded (FFPE) 4 × 4 μm tissue sections of primary tumors and matched brain metastases using RNeasy FFPE kit (Qiagen, Hilden, Germany) per manufacturers’ instructions ...