Labshake search
Citations for Qiagen :
401 - 450 of 1976 citations for Tumor Necrosis Factor Alpha Induced Protein 2 TNFAIP2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... RNA and protein were extracted 6 days post-transduction using the AllPrep RNA/Protein kit (Cat: 80204, Qiagen, Germantown, MD USA). RNA was converted to cDNA using SuperScript IV cDNA Synthesis Kit (Cat ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated with primary antibody (Penta·His Antibody, QIAGEN®, 1:2000 dilution) in 1% bovine serum albumin in PBST for 2h at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... and the 6xHis-SUMO tagged proteins were purified from the soluble protein fraction after centrifugation using an Ni2+-NTA Superflow column (Qiagen, Venlo, Netherlands). Next ...
-
bioRxiv - Cancer Biology 2021Quote: The recombinant hexahistidine-tagged TNC-C and EDB WT and mutant proteins (at 60 μg of protein / 40 μl beads in PBS) were immobilized to Ni-NTA Magnetic Agarose Beads (QIAGEN, Hilden, Germany) at RT for 1 h ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA and protein fractions using silica-membrane spin columns from the AllPrep DNA/RNA/Protein kit (cat# 80004, Qiagen, Chatsworth, CA, USA). PBMCs were processed in a randomized order ...
-
bioRxiv - Neuroscience 2023Quote: PFC and HPC RNA and protein were extracted following the instructions of the Allprep RNA/protein kit (cataloge no. 80404; Qiagen, Hilden, Germany). RNA was measured by nanodrop ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... His-tagged proteins were purified on NiNTA beads (Qiagen). Purified proteins were eluted with 500 mM NaCl ...
-
bioRxiv - Genomics 2019Quote: We used Allprep DNA/RNA/Protein mini kit (Qiagen) for DNA isolations from FNAs and QIAamp DNA Kit for blood and plasma ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA extraction with All Prep RNA/Protein Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... RNA and Allprep DNA RNA Protein Mini Kit (QIAGEN) extraction kit according to the manufacturer’s specifications.
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were purified with Ni-NTA affinity resin (Qiagen). The aminoacylation assay protocol from Jiongming Lu was then followed (Lu et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein were purified using Ni-NTA agrose (Qiagen, 30210) according to the manufacturer’s manual ...
-
bioRxiv - Biochemistry 2021Quote: ... Soluble protein was mixed with Ni-NTA resin (Qiagen) for 1h at 4 degrees on a nutator ...
-
bioRxiv - Biochemistry 2020Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... purified N protein was incubated with RNAse A (Qiagen) with 1:15 (RNAse A ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were either purified using NI-NTA agarose (Qiagen) or anti C-tag beads ...
-
bioRxiv - Plant Biology 2021Quote: ... labeled proteins were incubated with Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at RT ...
-
bioRxiv - Plant Biology 2021Quote: ... recombinant protein and purified using Ni-NTA resin (Qiagen). Polyclonal antibodies were raised in mice as described in 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant protein was purified using Ni-NTA agarose (Qiagen). Rabbit polyclonal antibodies were generated by Covance ...
-
bioRxiv - Biochemistry 2021Quote: ... the protein was purified by Ni-NTA agarose (Qiagen) and eluted with lysis buffer containing 300 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: Protein was purified using Ni-NTA agarose column (Qiagen). A detailed protocol is described in supplementary materials and methods.
-
bioRxiv - Genetics 2021Quote: ... The AllPrep DNA/RNA/Protein Mini Kit (Qiagen 80004) was used to extract total RNA in DEPC-treated water ...
-
bioRxiv - Neuroscience 2020Quote: ... GAPDH protein was purified by Ni-NTA chromatography (Qiagen) under native conditions ...
-
bioRxiv - Biophysics 2021Quote: ... Proteins were purified using Ni-NTA resin (Qiagen, Germany) on a gravity flow column followed by size-exclusion chromatography on a Superdex® 200 Increase 10/300 GL column (GE Healthcare Life Sciences ...
-
bioRxiv - Biophysics 2020Quote: ... Protein purification was performed using Ni-NTA resin (Qiagen) equilibrated with the lysis buffer containing 20 mM imidazole ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were purified by Nibaffinity (Ni-NTA agarose, Qiagen) then passed over an anion-exchange column (Hitrap Q HP ...
-
bioRxiv - Genomics 2019Quote: ... We added 200 µl of Protein Precipitation Solution (Qiagen) and centrifuged at 15,000 rpm for 3 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Genes for protein purification were cloned into pQE30 (QIAGEN). Raw 264.7 and U937 cells were cultured in RPIM1640 medium in the presence of 10% FBS ...
-
bioRxiv - Genomics 2020Quote: ... total proteins and RNA were extracted (RNeasy Qiagen 74104) according to the manufacturer’s instructions and analyzed.
-
bioRxiv - Microbiology 2023Quote: ... The proteins were purified with Ni-column chromatography (Qiagen) by following the manufacturer’s recommendations.
-
bioRxiv - Biochemistry 2023Quote: ... Fusion proteins were purified through consecutive Ni-NTA (Qiagen), amylose (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was purified through Ni-NTA agarose beads (Qiagen) (Lysis Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Expressed proteins were captured on Ni-NTA Superflow (Qiagen) equilibrated with Buffer A containing 5 mM imidazole ...
-
bioRxiv - Biochemistry 2023Quote: ... protein was captured using Ni-NTA affinity chromatography (Qiagen). Protein was further purified using ion exchange chromatography preceding size exclusion chromatography on a HiLoad 16/600 Superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was purified with Ni-NTA Agarose (Qiagen), dialyzed to PBS containing 6 M urea ...
-
bioRxiv - Biochemistry 2024Quote: ... protein purification was performed using Co+NTA agarose (Qiagen), followed by a Phenyl Sepharose column ...
-
bioRxiv - Immunology 2020Quote: ... and detection was performed using anti-His antibody (Penta-His Antibody, #34660, Qiagen) followed by donkey-anti-mouse antibody labeled with AlexaFluor647 (Invitrogen ...