Labshake search
Citations for Qiagen :
51 - 100 of 2978 citations for Triclosan 13C12 99% 100 Ug Ml In Mtbe 2 4 4 Trichloro 2 Hydroxydiphenyl Ether since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... 3-4 mL of Ni-NTA superflow resin (Qiagen) were loaded onto a column and equilibrated with the resuspension buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Those included UniSpike 2 and 4 from the QIAGEN RNA Spike-In Kit (Cat. No.: 339390, QIAGEN, Hilden, Germany), which were used to monitor RNA isolation efficacy ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Genomics 2022Quote: ... Samples were incubated overnight at 55°C before adding 2 µl of RNaseA (100 mg/ml, Qiagen) and incubated for 15 min at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cotyledons from 100 plants were dissected and ground in 2 ml tubes using a Tissue Lyser (Qiagen) for 1 min 30 sec at 30 Hz before RNA extraction using the RNeasy micro kit (Qiagen) ...
-
bioRxiv - Genomics 2023Quote: ... and 20 ug/mL RNase A (Qiagen, 19101) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... and 20 ug/mL RNase A (Qiagen, 19101) for 1 hour at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: A total of 600 μL (three × 200 μL) of day 4 SARS-CoV-2 culture supernatant was used as input into the RNeasy Mini Kit (Qiagen) for RNA extraction with minor modifications ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA of 2 – 4 dpf zebrafish embryos was extracted using Trizol reagent and purified using the RNeasy Mini Kit (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed with 2 µL (∼16 ng) or 4 µL (∼32 ng) of BT-converted DNA with HotStar Taq Polymerase (Qiagen), depending on the genomic region ...
-
bioRxiv - Microbiology 2020Quote: ... and then with (2) 15 µl Proteinase K [>600 mA/ml] and 5 µl Rnase A [100 mg/ml] (Qiagen, Germany) for 5min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with 4 mg/mL RNase A (Qiagen 158922) diluted 1:286 in 2X SSC for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The incubation period at 56°C was set to one hour for all samples and all samples were treated with 4 µl RNase A (100 mg/ml, Qiagen). DNA was eluted in 100 µl TE buffer with 0.1 mM EDTA ...
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Immunology 2024Quote: 2 ml MaXtract High Density tubes (Qiagen, 129056) were centrifugated at 12,000–16,000 × g for 20-30 second centrifugation ...
-
bioRxiv - Physiology 2020Quote: ... Groups of five flies were transferred to 2 mL tubes and were homogenized in 100μl PBS + 0.1% Triton X-100 using a TissueLyser LT (Qiagen). The samples were then spun down at 12,000 rpm and the supernatant transferred to fresh vials and the absorbance of each sample at 603 nm was measured using a NanoDrop ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
bioRxiv - Genomics 2022Quote: ... Day 145) for n=4 clams for each treatment (Figure 2) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen USA) according to manufacturer’s instructions with slight modifications ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged at 5000 g for 2 hours at 4 °C and the pellet was collected for DNA extraction with a DNeasy PowerSoil kit (Qiagen, Germany). The sediment from Lime Blue was collected with a freeze core (modified from Stocker and Williams ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Halo protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9 wash buffer I (50 mM NaxPO4 pH 7.0 and 300 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... dCas9-Cys protein was purified from the supernatant by incubating for 2 h at 4 °C with Ni-NTA agarose (Qiagen #30210). The beads were washed 10 times with 5 ml dCas9-Cys wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA concentration and purity were measured by a spectrophotometer and 2 ug were used to synthesize cDNA by QuantiTect Reverse Transcription kit (Qiagen). Real-time amplification was performed in a Mastercycler EP Realplex (Eppendorf ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Maize and soybean leaf and root tissue were pulverized for 2-min at a speed of 30 Hz with two 4-mm stainless balls in a TissueLyser II (Qiagen, Venlo, Netherlands). Total DNA was extracted from plant tissues with the OMEGA Mag-Bind Plant DNA Plus kit (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed twice with PBS and then resuspended in Propidium Iodide (PI) staining solution (1x PBS supplemented with 50 µg/mL PI, Invitrogen; 100 µg/mL RNase A, Qiagen; and 2 mM MgCl2) and incubated for 30 min at room temperature in the dark) ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... After 14 h binding to 4 mL Ni-NTA agarose beads (Qiagen), the beads were first washed with 15 mL Ni-NTA binding buffer and then with 15 mL Ni-NTA wash buffer (1 M NaCl ...
-
bioRxiv - Bioengineering 2021Quote: ... Sample supernatants were incubated with 4 mL of Ni-NTA Agarose (Qiagen) for >1 hour at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Removed culture was mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) for stabilization and incubated for 5 min at room temperature before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mL of nickel-charged resin (Qiagen, Ni-NTA Agarose) was added to a column (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... in a 2 mL cryovial using a tissue lyser (Qiagen) and 0.2mm ceramic beads ...
-
bioRxiv - Developmental Biology 2019Quote: ... slides were treated with 2 μg/ml Proteinase K (QIAGEN) for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... coverslips were treated with 2 mg/ml RNase A (QIAGEN) for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... then loaded on to 2 mL Ni-NTA column (Qiagen) pre-equilibrated with 10 column volumes of 50 mM Tris pH 7.5 containing 300 mM NaCl ...
-
bioRxiv - Microbiology 2023Quote: ... fitted with a 2 ml tube holder (Qiagen, Germantown, MD). RNA was purified with the ZymoBIOMICS RNA Miniprep kit (R2001 ...