Labshake search
Citations for Qiagen :
351 - 400 of 1538 citations for TROP 2 Human 248a.a HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated for 1 hour with monoclonal α-His antibodies conjugated to the horseradish peroxidase (1:5000 dilution; Qiagen). Blots were visualized with the addition of Lumina Forte Western HRP Substrate (MilliporeSigma ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... HIS-fused p300 was expressed from pFastBac1 vector in High-Five cells and purified on Ni-NTA agarose beads (Qiagen, 30210) in BC buffer (20 mM HEPES pH7.9 ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged PSK1 or RGF1 precursors were purified from bacterial extracts by metal chelate affinity chromatography on NiNTA Agarose (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: The recombinant His-TvFACPα full-length protein was produced and purified by a standard protocol as suggested by the supplier (QIAGEN, Hilden, Germany) (48 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tag fusions were purified by incubating the bacterial soluble fraction with pre-equilibrated Ni-NTA agarose bead slurry (Qiagen, Hilden, Germany) for 1 hour at 4°C and eluting with 500 mM imidazole ...
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from human samples was extracted with PowerSoil Pro (Qiagen) on the QiaCube HT (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... the human Stress & Toxicity PathwayFinder RT2 Profiler™ technology (Qiagen), assessing expression of 84 stress response-related genes ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were then stained by Coomassie-blue or immunodetected as described before [26] using primary polyclonal antibodies directed against His6 epitope-tag (Penta His, Qiagen, dilution 1:1000), V5 epitope-tag (Bethyl Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 (DE3) and expression of the His-tagged Cas proteins was performed following the instruction of the protein purification kit (Qiagen, Valencia, CA, USA). Single colonies of transformed cells were cultivated overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Genetics 2022Quote: RNA from human ileal biopsies was extracted using RNeasy Mini Kit (Qiagen). 500 ng of RNA was reverse transcribed to cDNA using TaqMan Reverse Transcription kit (#N8080234 ...
-
bioRxiv - Cell Biology 2022Quote: FASTQ files generated by sequencing human macrophages were imported into ArrayStudio (Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were applied to the Human Aging RT2 Profiler PCR arrays (Qiagen) and run on Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Molecular Biology 2019Quote: Human islet RNA was extracted using the Qiagen RNeasy Kit (Qiagen; #74106) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: Human skin tissues were homogenized with RLT buffer (Qiagen, Hilden, Germany, 79216) supplemented with 1% β-mercaptoethanol (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for human ZMPSTE24 Hs_ZMPSTE24_1_SG QuantiTect) were predesigned and validated by QIAGEN and used diluted to a final work solution of 1x (QuantiTect Primers ...
-
bioRxiv - Developmental Biology 2023Quote: FlexiTube siRNA was used to knock-down human PDE2A (Cat#: SI00040159, Qiagen). AllStars Negative CTRL siRNA was used as control (Cat# ...
-
bioRxiv - Cell Biology 2024Quote: ... serially diluted matching human PCR amplicons cloned into the pDrive vector (Qiagen) were used to generate a standard curve ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Genomics 2019Quote: ... and human genomic DNA (extracted from cells with DNeasy Blood & Tissue Kit, Qiagen). One guide was used with the plasmid ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared using the QIASeq Human Comprehensive Cancer Panel Kit (Qiagen #333515) and sequenced on an Illumina HiSeq 2500 or NovaSeq 6000 ...
-
bioRxiv - Pathology 2019Quote: Total RNA of human podocytes was extracted per manufacturer’s instructions (Qiagen, Germantown, MD) and 1 μg RNA was used for cDNA synthesis (Transcriptor first strand cDNA synthesis kit ...