Labshake search
Citations for Qiagen :
551 - 600 of 1151 citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or miR-200b/200c on the ZC3H11A 3’UTR were obtained from Qiagen. TSBs were resuspended in ddH2O to prepare a 50 µM solution ...
-
bioRxiv - Biochemistry 2021Quote: ... The sample was then loaded onto 3 ml of Ni-NTA resin (Qiagen) by gravity at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... n=3) using the RNeasy Mini kit (Cat. No. 74104, QIAGEN, Hilden, German) and manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: PDGFRα+ and CD56+ cells (passages 3 to 5) were lysed in Qiazol (Qiagen) followed by chloroform/isopropanol total RNA extraction ...
-
bioRxiv - Microbiology 2020Quote: ... by bead beating (50 Hz for 3 five-minute cycles, TissueLyzer II (Qiagen) with 0.1 mm silica beads) ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated from 3 dpf larvae with the RNeasy mini kit (QIAGEN). A cDNA library was generated from the 3 dpf RNA using the high-capacity cDNA reverse transcription kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2020Quote: NALCN-siRNA and control-siRNA with modification of 3’-AlexaFluor488 (QIAGEN, Maryland, USA) were dissolved in RNase-free water (NALCN-siRNA ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from ~3×106 cells was extracted with DNeasy Blood&Tissue kit (Qiagen). For SUM159PT/MDA-MB-231 hybrids and MCFDCIS/SUM159PT from lung metastasis CytoSNP-12 v2.1 BeadChip array from Illumina was used and data analyzed with GenomeStudio 2.0 software (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... and 12-days post infection (3 samples/group) using the RNeasy Kit (Qiagen). Samples were processed at the Baylor College of Medicine Genomic and RNA Expression Profiling Core (Houston ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were cleaned of enzymes by adding 3× volume Buffer RLT (Qiagen, 79216) and 1× volume ethanol ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transfected with pNL4-3 vectors using Attractene Transfection Reagent (QIAGEN, Germany). After 8 hr ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatant was collected on day 3 post transfection and Ni-NTA agarose (Qiagen) was used to purify the protein ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Neuroscience 2022Quote: ... n = 3) from patient and control tissues using the RNeasy mini kit (Qiagen) and diluted to a concentration of 10ng/µL ...
-
bioRxiv - Microbiology 2022Quote: ... in microcentrifuge tubes with 3 mm Tungsten Carbide Beads (Qiagen, St. Louis, MO). Supernatants were clarified by centrifugation and frozen at -80ºC until viral titration ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we incubated samples with Qiagen Solution C3 (Qiagen DNeasy PowerSoil 12888-100-3) to remove PCR inhibitors ...
-
bioRxiv - Microbiology 2023Quote: ... Digested protein was mixed with 3 ml of NTA super-flow resin (Qiagen) that had been pre-equilibrated in wash buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and total RNA was extracted from 3 week-old plants by RNeasy (QIAGEN) or Direct-zol (ZYMO RESEARCH) ...
-
bioRxiv - Biophysics 2023Quote: The library preparation was done using the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). A total of 10ng purified RNA was converted into cDNA NGS libraries ...
-
bioRxiv - Genetics 2022Quote: ... 10 μg dsRNA were transfected into 3×106 Drosophila cells using Effectene (QIAGEN).
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from Calu-3 cells with RNeasy mini kit (Qiagen). Extracted RNA was quantified and purity was verified by Nanodrop 2000 spectrophotometer (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleared and filtered supernatants were applied to 3 mL Ni-NTA Agarose (QIAGEN) equilibrated in buffer B (20 mM HEPES/KOH pH 7.8 ...
-
bioRxiv - Plant Biology 2023Quote: ... Tissue was ground with 3 mm stainless steel beads in a TissueLyser (Qiagen) with intensity of 30 for 1 min ...
-
bioRxiv - Microbiology 2024Quote: ... 3 times for 30 s at 30 Hz using Tissue Lyser II (Qiagen). After centrifugation at 2,000 rpm for 5 min ...