Labshake search
Citations for Qiagen :
551 - 600 of 1937 citations for Somatostatin Receptor 1 SSTR1 Mouse Monoclonal biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... A total of 400 ng an RNA with RNA integrity number (RIN) greater than 8 from each sample was processed with QIAseq Targeted RNA Mouse Cancer Transcriptome Panel (Qiagen, Germany, RMM-003Z). This panel consists of 416 genes selected for the association with angiogenesis ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Flow-through was mixed 1:1 with 70% ethanol and passed through a RNeasy Mini column (Qiagen, #74104). After centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼8 ml PCR product (azide-DNA:2xbiotin-DNA = 1:1) was purified using HiSpeed Plasmid Maxi kit (Qiagen) in 1 ml NaHCO3 (pH 8.3) ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA) (Qiagen, Hs_PLCE1_1, SI00115521); negative control siRNA (UUCUCCGAACGUGUCACGUdTdT ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing DNase I (1 mg/ml, Qiagen) at 37 °C for 5 min with gentle shaking ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 ml of Proteinase K (Qiagen, 19131) was added to the tube and vortexed for 5 seconds ...
-
bioRxiv - Systems Biology 2022Quote: ... resuspended in 1 mL QIAzol reagent (Qiagen) and stored at -80 °C.
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 mL of Ni-NTA Agarose (Qiagen) was added to a 15 mL polypropylene gravity flow column (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). A positive control of DNA extracted from commercially available Agaricus bisporus provided by Dr ...
-
bioRxiv - Genomics 2019Quote: ... and 1 U Taq DNA polymerase (Qiagen). The fungal-specific ITS1F/ITS4 and bacteria-specific 341F/805R primer pairs were used for each sample in two independent PCR reactions ...
-
bioRxiv - Genetics 2019Quote: ... 1×106 cells using RNeasy Kit (Qiagen), followed by DNase digestion using TURBO DNase (Thermo Fisher) ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 1 unit of HotStar Plus Taq (Qiagen), 200 nM of each primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM DTT using a TissueRuptor (Qiagen). The homogenate was then centrifuged 5 min at 2,500 x g at 4°C and the supernatant transferred to a new tube on ice followed by further homogenisation using a 27G needle and syringe ...
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1) DNeasy PowerLyzer PowerSoil Kit (QIAGEN®), 2 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ni-NTA agarose beads (1 ml; Qiagen), washed and resuspended in loading buffer (50 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... 1-unit HotStarTaq Plus (QIAGEN, Cat#: 203607), 190 nM 3’ primer pool ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... 25 nM of S1PR1 #1 (Qiagen, #SI00376201) 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... stored in 1 ml RNAlater (Qiagen, Netherlands), and moved to a −20 °C freezer for up to a month until RNA was extracted ...
-
bioRxiv - Genetics 2019Quote: ... 1 μL of Q-Solution from Qiagen® and H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 uL ∼1.07 AU/mL Protease (Qiagen) was added to each well and incubated at 37 °C for 40 min ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... containing 1 × Master Mix (Qiagen Multiplex Kit), 0.4 μg/μL of BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL RNAProtect Bacterial Reagent (Qiagen, #76506) was added to each sample and thawed on wet ice for 10 min ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 25 mM MgCl2 (Qiagen) and 1 ul of the primer mix (40 uM of the Forward primer ...
-
bioRxiv - Neuroscience 2019Quote: ... Genomic DNA and RNA were extracted from male and female monkey and male mouse NAcC samples using the All Prep DNA/RNA/miRNA Universal kit (QIAGEN Sciences Inc, Germantown, MD) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: Bacterial DNA in the mouse fecal samples and GI content (200 mg) was extracted using QIAamp® PowerFecal® Pro DNA kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... or WT-Cav-1 (1 µg) plus EphB1-Y600F-YFP (2.5 µg using Superfect transfection reagent (cat #301305, Qiagen). Media was replaced 6 h after transfection with fresh DMEM media containing 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of the 2-mL culture was removed and replaced by 1 mL of RNAprotect Cell Reagent (Qiagen). After 5 min of incubation ...
-
bioRxiv - Microbiology 2022Quote: ... 200 RPM for 2 h then approximately 1×109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 10-day-old whole seedlings grown on 1/2X MS media containing 1% sucrose and 0.8% agar (Plant RNeasy kit (Qiagen)) ...
-
bioRxiv - Microbiology 2023Quote: TG was quantified in snap-frozen liver tissue stored at −80 □C until cryo-grinding in liquid nitrogen and 50 ±5 mg tissue added 0.9 mL of a 2:1 chloroform:methanol solution and homogenized 1 min at 50 os/sec using a TissueLyser LT (Qiagen) with beads ...
-
bioRxiv - Systems Biology 2023Quote: ... x mg solid matrix were mixed with five times the μl amount of ACN:water (1:1, v/v) and homogenised with a TissueLyser II (30 Hz, 10 min; Retsch Qiagen). After a short centrifugation (2 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µg⋅ml –1 Leupeptin and 3 mM Benzamidine) with steel beads at 28.5 Hz for 1 min (Qiagen TissueLyser II ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA from mouse forelimb buds and bamboo shark pectoral fin buds was extracted with the RNeasy Micro and Mini plus kit (QIAGEN, Cat. No. 74034 and 74134). Genomic DNA was removed with gDNA Eliminator columns included with this kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 1 μl 1:10 diluted oligonucleotides (for RNA from immunopurified ribosomes) from the QIAseq FastSelect –rRNA Yeast Kit (Qiagen) in 10.5 μl total at 75°C ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from circulating PD-1+ and PD-1− CD8+ T cells using the All-Prep DNA/RNA Micro Kit from Qiagen and sent to Adaptive Biotechnologies for survey-level TCRβ sequencing.
-
bioRxiv - Microbiology 2019Quote: ... A second round of amplification was performed by transferring 5µl of 1:100 diluted Round 1 product into 15µl Fast Cycling PCR Mix (QIAGEN, Hilden, Germany) reactions ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from FACS purified Zeb1+ (Lineage−Sca-1+CD49fhi tdTomato+) or Zeb1− basal cells (Lineage−Sca-1+CD49fhitdTomato−) using a RNeasy micro kit (Qiagen). cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara) ...