Labshake search
Citations for Qiagen :
151 - 200 of 898 citations for Siglec 15 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... The MBP/His-tagged proteins were purified using Ni2+-NTA agarose (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: His-tagged MCP/scFv-GFP was purified with Ni-NTA-agarose (Qiagen) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cell Biology 2020Quote: ... HIS-TRIM39 proteins were purified on Ni-NTA agarose beads (Qiagen, #1018244) and then eluted in a buffer containing 0.5 M imidazole before dialysis in PBS.
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The His-tagged ACE2 protein was then purified by Ni-NTA (QIAGEN) affinity purification ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tag proteins were purified using a Ni-NTA purification system (Qiagen) by following the specification of the manufacturer ...
-
bioRxiv - Plant Biology 2022Quote: ... and SUMO-HIS-BIN2 protein was purified with Ni-NTA Agarose (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: ... His-tagged VndA was purified over a Nickel-NTA agarose resin (Qiagen) according to manufacturer’s recommendation ...
-
bioRxiv - Biochemistry 2023Quote: ... His-tagged σNS was loaded onto a Ni-NTA agarose column (Qiagen) and eluted using a gradient of 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged protein was purified on a 1ml Ni-NTA column (Qiagen) prewashed in buffer A containing 500mM imidazole w/o β−mercaptoethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6x-His-tagged proteins were captured using Ni-NTA Superflow (QIAGEN) and the His-tag was cleaved at 4 °C for 16-18 hours by human thrombin (Biopharm laboratories) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the solubilized His-tagged histones were purified using Ni-NTA beads (Qiagen). For untagged H2B ...
-
bioRxiv - Biochemistry 2023Quote: ... and the His-tagged proteins were purified with HisBind NiNTA-agarose (Qiagen) according to the recommendations of the supplier ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen) for purification ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen). Proteins were washed two times with 750 μl of buffer A (or AG ...
-
bioRxiv - Immunology 2023Quote: ... and 15 µl of HiPerFect (Qiagen) transfection reagent was added ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from HEK293 cells using the QIAshredder and RNeasy Mini kit (Qiagen, 79654 and 74104, respectively). Briefly ...
-
bioRxiv - Biophysics 2021Quote: The His-tagged TCF7L2 constructs were affinity purified using Ni-NTA agarose (Qiagen) and the tagged cleaved from the protein using thrombin ...
-
bioRxiv - Microbiology 2019Quote: ... the fusion protein was purified using His-Bind columns (Qiagen, Venlo, The Netherlands) and analyzed by SDS-PAGE using gels containing 12% polyacrylamide ...
-
bioRxiv - Molecular Biology 2021Quote: ... His-tagged proteins were purified on Ni-NTA agarose (Qiagen; catalog no. 30761) and GST-tagged TopBP1 protein was purified on Glutathione Sepharose™ 4B (GE healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... Western blot analysis was performed using the Penta His HRP conjugate kit (Qiagen). To check for equal loading ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP was first isolated using Ni-NTA beads (Qiagen, Valencia, CA) using a buffer with an imidazole gradient (20 mM Bis-Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... The His-tagged TEV protease was removed by incubation with Ni-NTA (Qiagen) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... a penta-His HRP conjugate was used (1:4000, QIAGEN GmbH, Hilden, Germany). The detection of GFP was performed with the primary antibody anti-GFP (1:10000 ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant His-tagged GAPDH was purified using Ni-NTA Agarose (Qiagen, Valencia, USA) in native conditions according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: Assay mixes consisted of 25 nM ALEXA488-conjugated penta-His antibody (Qiagen # 35310), 50 μM DTT ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-tagged fusion proteins were purified with a Ni-NTA column (Qiagen), and the elution fraction was incubated with TEV protease for 15-18 h at 4°C to cleave the N-terminal His-tag ...
-
bioRxiv - Microbiology 2022Quote: ... His-Hcp was purified from the soluble fraction by NTA-resin chromatography (Qiagen). Purified protein was desalted with a PD-10 desalting column (GE Healthcare ...
-
bioRxiv - Plant Biology 2022Quote: ... Target protein was recovered and purified with a His-Trap affinity column (QIAGEN) according to manufacturers’ protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Preparation of his-tagged recombinant proteins was performed according to manufacturer instructions (Qiagen). Preparation of GST-tagged recombinant proteins was performed according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Each His-tagged protein in media was captured with Ni-NTA resin (Qiagen) and eluted with DPBS containing 150 mM imidazole.
-
bioRxiv - Neuroscience 2024Quote: ... The His-tagged nanobodies were purified by using Ni-NTA purification column (Qiagen) followed by desalting step using disposable PD-10 desalting columns (Cytiva ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged SLFN11 (residues 349-901) was purified by Ni-NTA beads (Qiagen). All purified GST- or His-tagged proteins were dialyzed against a buffer containing 50 mM Tris-HCl and 150 nM NaCl and validated by Coomassie blue-stained SDSLJPAGE.
-
bioRxiv - Cancer Biology 2024Quote: rEDA was produced intracellularly using the pQE-30 His tag purification system (Qiagen) in E ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 1.0–3.0 μl (5.0–15 pmol) of primers and 7.5–15 μl of 2x Multiplex PCR Plus Master mix (QIAGEN). The PCR protocol consisted of an initial DNA polymerase (HotStar Taq ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0) containing 15 mg/mL of lysozyme + 15 µL of proteinase K solution (20 mg/mL, Qiagen), and then incubated for 8–10 min ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extractions were carried out using the Biosprint 15 DNA Plant Kit and Biosprint 15 robot (Qiagen, Australia) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 15 min of DNase I (Qiagen) treatment according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... 15 µl of Pyrosequencing Annealing Buffer (Qiagen) were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 15 min of DNase I (Qiagen) treatment.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each of 15 μL of EB (Qiagen) buffer incubated at 37 C for 10 minutes.
-
bioRxiv - Cancer Biology 2019Quote: ... 200nM siRNA/well were used for transfection using 5µl/well of Hi-Perfect (Qiagen) following manufacturer’s recommendation.
-
bioRxiv - Biophysics 2021Quote: ... coli and purified by His-tag affinity purification using Ni-NTA agarose beads (Qiagen) followed by ion exchange purification using a mono-Q HR 5/5 column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were probed with antibodies against His6 (penta-His Qiagen catalog #34460; 1:10,000), FLAG2 (Sigma catalog #A8592 ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... His-βC1 fusion proteins were purified using Ni-nitrilotriacetate (Ni-NTA) agarose (Qiagen, 30210) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.