Labshake search
Citations for Qiagen :
251 - 300 of 876 citations for SARS Coronavirus Nucleoprotein C Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 4°C) and stored at −80°C before metagenomic extraction using the DNeasy PowerSoil kit following manufacturer specifications (QIAGEN, Hilden, Germany). All sampling and sample processing was conducted following cold chain principles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... of Gibson Assembly reaction mix was added to NEB Stbl cell (C3040) for transformation and grown at 30°C or 37°C for the plasmid DNA preparation (Qiagen miniprep). The resulting plasmids were sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Genomics 2021Quote: ... coli K12 MG1655 genomic DNA was extracted from a cell culture using the DNEasy Blood and Tissue kit (69504, Qiagen). All the other gDNA from the bacteria presented in Table 1 were isolated using the Monarch genomic DNA purification kit (T3010S ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli strain (Rosetta) and purified using Ni-NTA affinity chromatography according to the manufacturer’s instructions (Qiagen Cat No./ID: 30210). Purified protein was used as an immunogen to raise polyclonal antibody in rabbits at a local commercial facility (DPL ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Microbiology 2020Quote: ... coli isolates with QIAmp DNA mini kit or using an EZ1 Biorobot with the DNA Tissue kit (Qiagen, Hilden, Germany). The Nextera XT Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... All the plasmids were transformed in to Escherichia coli DH10B electro-competent cells selected with appropriate antibiotics and purified using a Qiaprep Spin Miniprep Kit (Qiagen). Positive clones were transformed in Agrobacterium tumefaciens strain GV3101 and used in infiltrations for transient expression experiments.
-
bioRxiv - Microbiology 2021Quote: ... The new plasmid construct (pSLP15) was transformed into Escherichia coli DH5α chemically competent cells and prepped using the QIAprep spin miniprep kit (Qiagen). Plasmid concentrations were determined using the Qubit dsDNA broad range assay kit with a Qubit 3 fluorometer (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... coli HST04 dam-/dcm- strains in which target MTases were transformed were extracted using the DNeasy UltraClean Microbial Kit (QIAGEN) according to the supplier’s protocol after induction of gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... coli cells were then grown to isolate the pooled plasmid library by using a Plasmid Midi kit (Qiagen, Germantown, MD) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: During this time a stock of genomic DNA (gDNA) from Escherichia coli (REL606) from ∼72 mL of overnight culture was made using the “DNeasy Ultraclean Microbial kit” (Qiagen), resulting in a stock of ∼30 mL of gDNA at 20 μg/mL (stored at -20 °C) ...
-
bioRxiv - Biophysics 2023Quote: ... coli strain M15-[pREP4] (for transformation of recombinant plasmids) and RNAse (for protein purification) were purchased from Qiagen (Valencia, CA). All other chemicals were obtained from Sigma-Aldrich (St ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids pGS001 and pOXC101(33) were extracted from Escherichia coli DH5α and β3914 respectively using the QIAprep Spin Miniprep Kit (Qiagen). A tac promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli XL1-blue strain was transformed and plasmids were isolated from bacterial cultures using the Plasmid Midi Kit (Qiagen, Germany). Sequencing of the three NS1 plasmids was performed by Eurofins (Germany).
-
bioRxiv - Immunology 2021Quote: ... Serum was stored at −80°C as well as tissue samples were stored at −80°C or in RNAlater (Qiagen, Hilden, Germany) at −20°C.
-
bioRxiv - Plant Biology 2022Quote: Total root RNA was extracted from plantlets grown in vitro at 22 °C and 10 °C using the RNeasy®Plant Mini Kit (QIAGEN, Germany). One microgram of total RNA was reverse transcribed using an oligo(dT)20 primer and the Super Script™ IV RT (lnvitrogen,USA ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCOs were stored at -80°C in RNAlater (Qiagen) until library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and further disrupted by TissueLyser II (QIAGEN, C.0659). 100 mg ground sample was first resuspended in 1 mL lysis buffer (1×PBS ...
-
bioRxiv - Physiology 2021Quote: ... Crtc2 and GFP expression plasmids were purified from DH5a Escherichia coli cultures using an EndoFree plasmid kit (Qiagen, Valencia, CA, USA), and resuspended in 71 mM sterile PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... coli strain BL21(DE3)(Novogen Inc.) essentially as described [34] except that after elution from Ni-NTA agarose resins (Qiagen Inc.) by incubating with 400 mM imidazole for 1 hr at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... we cultured 250 ml Escherichia coli bacteria bearing transformed plasmids and isolated the plasmids using Qiagen Maxi-Prep Endotoxin-free kit (Qiagen; 12362) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... 128° 11’ 17.2” E) and the genomic DNA was extracted from the whole bodies using DNeasy® Blood & Tissue kit (Qiagen, GmbH, Hilden, Germany). Illumina libraries for whole bodies were constructed using the TruSeq Nano Sample Prep kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... All UNG constructs were expressed in the Escherichia coli BL21(DE3) ung-151 strain and purified using Ni-NTA affinity resin (Qiagen, Hilden Germany) as described previously (Róna et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... coli as an N-terminal histidine-tagged protein isolated from cell lysate after passage through Ni-NTA agarose (Qiagen, Cat. No. 30210). Bound TTRL55P was then eluted by competition with imidazole ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA from Escherichia coli MG1655 was isolated using the PowerLyzer® UltraClean® Microbial DNA Isolation Kit from Qiagen (Hilden, Germany). Bacterial cells were harvested and lysed using glass microbeads ...
-
bioRxiv - Pathology 2021Quote: ... coli 62-57nal using the Qiagen DNeasy Blood and Tissue Kit following the manufacturer’s specifications for bacterial cells (Qiagen, Cat No. 69504). Isolated genomic DNA was sequenced on the Illumina MiSeq platform using Illumina V2 500 cycle reagent chemistry generating paired-end 250 bp reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... hirae V-ATPase was expressed recombinantly in Escherichia coli and purified by affinity purification with a Ni+-NTA (nitrilotriacetic acid) column (Ni+-NTA Superflow; Qiagen, Hilden, Germany). The column was preconditioned with buffer consisting of 50 mM potassium phosphate ...
-
bioRxiv - Microbiology 2023Quote: ... coli following a standard heat shock protocol then isolated by miniprep (Cat. No. 27104, QIAprep Spin Miniprep Kit, Qiagen, Germantown, MD, USA) following the manufacturer’s instructions and eluted in molecular grade water to minimize the salt concentration for electroporation into N ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was prepared from day one adult animals raised at 25°C or 20°C by using RNeasy® Mini Kit (Qiagen, Venlo, The Netherlands). endu-2(tm4977 ...
-
bioRxiv - Immunology 2020Quote: ... were either frozen at −80°C in RLT buffer (Qiagen) for future RNA extraction or snap frozen using O.C.T.™ and preserved at −80°C ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was obtained from Escherichia coli TOP10 cells harboring pMBLe-OA-ArK using QIAprep Spin Miniprep Kit following manufacturer instructions (Qiagen Germantown, MD, USA).
-
bioRxiv - Genetics 2021Quote: ... Tissue was lysed at 55°C in Cell Lysis Solution (Qiagen) containing Proteinase K (Qiagen) ...
-
bioRxiv - Biophysics 2021Quote: ... at 20°C overnight and purified using Ni-NTA agarose (Qiagen) followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... three of which were stored at −80 °C in PowerFecal (Qiagen) 2 mL screw-cap bead tubes until ready for DNA extraction (within 1-3 months) ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4 and stored at −20 °C in RNAlater solution (Qiagen). RNA was extracted using RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... or DNAse (200 Units well−1, 1 hr, 37°C, Qiagen). DAPI was stained at 0.5 μM (5 mins ...
-
bioRxiv - Microbiology 2022Quote: ... at −80 °C using the RNeasy plus Mini Kit (Qiagen, 74134) according to the manufacturers protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... or Ni-NTA agarose column (Qiagen, for 6XHis-EIN2-C purification) according to manufacturer’s menu followed by sonication ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Plant samples were homogenized at -80 °C in a TissueLyser (Qiagen) and resupendend in a 10-fold excess of 80% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... coli) – were subject to total DNA extraction using the Gram-positive bacteria extraction protocol of the Qiagen DNeasy kit (Qiagen, Chadstone Centre, VIC, Australia). DNA quantities were measured on the Qubit 4 fluorimeter (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... overnight at 37 °C and purified by a PCR purification kit (Qiagen). Subsequently ...
-
bioRxiv - Neuroscience 2020Quote: ... at −80°C until RNA extraction using the RNeasy Mini Kit (Qiagen). RNA quality was determined using the RNA nano assay on a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA samples were stored at -20°C in AE buffer from Qiagen DNeasy Plant Mini Kit.
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...