Labshake search
Citations for Qiagen :
401 - 450 of 1311 citations for SARS CoV 2 Nucleoprotein His Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Cell debris was removed by centrifugation and His-tagged ClpC1 proteins were purified from supernatants with Ni-NTA agarose beads (Qiagen). After washing in binding buffer supplemented with 20 mM imidazole ...
-
bioRxiv - Plant Biology 2023Quote: ... This clarified extract was used for the purification of the His-tagged proteins using Ni-NTA agarose resin (Qiagen, USA). The agarose resin was washed twice by resuspending in lysis buffer followed by centrifugation at 3000 rpm and removing the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... and the purity of the purified proteins was checked by SDS-PAGE and western blot using anti-His antibody (1:1000, Qiagen) as primary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... pH was adjusted to 8 after resuspension to allow the binding of 6x His-tagged toxins to Ni-NTA agarose resin (reference: 30210; Qiagen). Resulting samples were passed through chromatography columns containing the Ni-NTA agarose resin and were eluted with denaturing buffer containing increasing concentrations of Imidazole (10 mM ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads ...
-
bioRxiv - Cell Biology 2023Quote: ... and purified His-Cdk9 (1 μM) in total volume of 300 μl were added to 50 μl of Ni-NTA agarose (Qiagen) equilibrated with binding buffer 1 (25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2023Quote: ... Tris–HCl 20 mM (pH 7.5)) by sonication and the His-tagged proteins were purified on a Ni-NTA column (Qiagen Inc.), eluted with imidazole in buffer A but complemented by ATP 1 mM + MgCl2 3 mM in the case of the Vibrio cholerae helicase ...
-
bioRxiv - Microbiology 2023Quote: ... GnTi expressed His-tagged gp140s and gp120s were purified from the harvested and clarified supernatant using Ni-NTA agarose beads (Qiagen) following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Actin was used as a housekeeping gene to normalize the amount of viral RNA by using the qPCRBIO SyGreen mix HI-ROX (PCR Biosystems) together with QuantiTect primer assay (QT01680476, Qiagen). All Quantitative PCR (qPCR ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were collected by double centrifugation and 6x His-tagged target protein in the supernatant was purified using the medium by Ni-NTA (Qiagen) affinity chromatography ...
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 (DE3) as fusion proteins containing an N-terminal His6- tag and purified by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). Full-length DosR was also expressed with N-terminal GST-tag ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Cell Biology 2021Quote: ... For PCR amplification of the V5 tag cDNA was extracted from cells and a PCR was performed using the QIAquick PCR purification kit (QIAGEN) and the following primer sequences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was isolated before (T1) and after (T2) the sample-tag staining procedure using the RNeasy Mini kit (Qiagen) and RNA quality (RNA integrity number ...
-
bioRxiv - Systems Biology 2022Quote: ... The IL2Rα ectodomain was generated to include a C-terminal 6xHis tag and then purified on Nickel-NTA spin columns (Qiagen) according to manufacturer instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Ligated fragments were then amplified for 12-15 cycles using primers incorporating unique dual index tags with VeraSeq polymerase (Qiagen). Fragments were sequenced on an Illumina NovaSeq-6000 using paired end reads extending 150 bases.
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged CLEL6 precursor was purified from bacterial extracts by metal chelate affinity chromatography on Ni-NTA Agarose (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... Input (3% of total binding reaction) and bound samples (50% of binding reaction) were subjected to SDS-PAGE followed by immunoblot analysis with His (Qiagen 34660) and GST (BioLegend MMS-112P ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
bioRxiv - Biochemistry 2021Quote: ... The coverslips were then incubated for ~ 10 min with 4 μg/ml of Penta•His biotin conjugate antibody (34440, Qiagen, UK) in reaction buffer [40 mM HEPES buffer (pH 7.3 ...
-
bioRxiv - Molecular Biology 2022Quote: Nunc MaxiSorp™ 96-well plates were coated with 75 ng/well of penta-His antibody in PBS solution (Qiagen, 34660) and incubated overnight at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: Lysates of His-tagged α-catenin WT and Δmod were bound to Ni-NTA (Ni2+-nitrilotriacetic acid)-sepharose affinity chromatography (Qiagen), washed with 50 mM Tris pH 7.8 ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from 1,000 H3K27me3 HI/LO β-cells or from 50,000 sorted βHI and βLO cells was extracted using the miRNeasy FFPE Kit (QIAGEN, 217504), followed by the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (E6420L) ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated for 1 hour with monoclonal α-His antibodies conjugated to the horseradish peroxidase (1:5000 dilution; Qiagen). Blots were visualized with the addition of Lumina Forte Western HRP Substrate (MilliporeSigma ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... HIS-fused p300 was expressed from pFastBac1 vector in High-Five cells and purified on Ni-NTA agarose beads (Qiagen, 30210) in BC buffer (20 mM HEPES pH7.9 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mUHRF1 C-terminally tagged with GFP- and 6xHis-tag was expressed in HEK 293T cells and then purified using Qiagen Ni-NTA beads (Qiagen #30230). Recombinant mDPPA3 WT and 1-60 were purified as described above ...
-
bioRxiv - Immunology 2023Quote: For protein production a pT350 plasmid encoding for the construct of interest with a BiP signal sequence in the N-terminal and a double strep-tag in the C-terminal region was co-transfected with a puromycin resistant plasmid (pCoPuro) (61) with effectene reagent (Qiagen, 301425) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged PSK1 or RGF1 precursors were purified from bacterial extracts by metal chelate affinity chromatography on NiNTA Agarose (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: The recombinant His-TvFACPα full-length protein was produced and purified by a standard protocol as suggested by the supplier (QIAGEN, Hilden, Germany) (48 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis of 100 ng total RNA was performed with miRCURY LNA RT Kit (10 µl volume reaction) which adds a 5’ universal tag of a poly(A) tail to mature miRNA templates (QIAGEN, Germantown, MD). cDNA template was diluted 1:10 ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 (DE3) and expression of the His-tagged Cas proteins was performed following the instruction of the protein purification kit (Qiagen, Valencia, CA, USA). Single colonies of transformed cells were cultivated overnight ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...