Labshake search
Citations for Qiagen :
301 - 350 of 762 citations for Rh Family C Glycoprotein RHCG Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... for 10 minutes at 37°C followed by a final clean-up with Qiagen RNeasy MinElute Kit (Qiagen, #74204) using default manufacturer’s protocol (which keeps RNAs > 200nt ...
-
bioRxiv - Microbiology 2023Quote: ... 37 °C) of strain GFKo1 grown in nutrient broth (Oxoid) using the Qiagen DNeasy Blood and Tissue Kit (Qiagen). Extracted DNA was adjusted to a concentration of 0.2 ng/μL and treated using the Nextera XT DNA library preparation kit (Illumina ...
-
Altered motility in response to iron-limitation is regulated by lpdA in uropathogenic E. coli CFT073bioRxiv - Microbiology 2023Quote: ... Strains were cultured for five hours at 37°C with aeration before harvest and treatment with bacterial RNAprotect (Qiagen). Bacterial pellets were stored at -80°C until RNA isolation.
-
bioRxiv - Microbiology 2023Quote: ... cholerae N16961 cultures grown in LB at 37°C in both exponential (OD600 0,8) and stationary (OD600 2,8) growth phases using the RNeasy® Mini Kit (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µl NEB2 buffer and 0.1 U enzyme were incubated 15 min 30°C and purified from unincorporated nucleotides using Nucleotide Removal Kit (Qiagen). Binding reactions were carried out in a total volume of 10 µl ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... cholerae WT and ΔSI cultures grown in LB at 37°C in both exponential (OD600 0,8) and stationary (OD600 2,8) growth phases using the RNeasy® Mini Kit (QIAGEN), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The soluble lysates obtained after two rounds of centrifugation at 18,000g and 4°C were incubated with glutathione agarose beads (Pierce) or Ni2+-NTA beads (QIAGEN). Recombinant proteins were eluted from the beads using 10 mM reduced glutathione in a Tris (50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1h at 37 °C (2 units per sample) followed by purification with the RNeasy miniElute Cleanup kit (Qiagen).
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lysates were further transferred to liquid N2/ -80 °C freezer before RNA purification according to Qiagen protocol (www.Qiagen.com ...
-
bioRxiv - Genomics 2024Quote: ... 72 °C for 1 min and then subjected to a 1.2x SPRI cleanup eluting in 42 µl EB buffer (Qiagen). Each sample was split into two fractions and each of them was further amplified with modality-specific primers ...
-
bioRxiv - Microbiology 2024Quote: ... Flag-SHOC2 was cleaved from 6X-His-MBP by incubating 37 mg purified protein with 0.65 mg TEV protease at 4°C overnight followed by affinity purification using Nickel affinity resin (Qiagen) where cleaved Flag-SHOC2 was collected in the flow-through.
-
bioRxiv - Microbiology 2023Quote: ... All samples were stored at -80°C until the DNA was extracted using the DNeasy PowerSoil Pro Kit (Qiagen). A blank DNA extraction was included to account for possible contaminations ...
-
bioRxiv - Microbiology 2024Quote: ... Lysates were clarified by centrifugation at 21,000× g at 4°C and loaded onto gravity flow Ni-NTA agarose columns (Qiagen), followed by washing with 50 mM HEPES pH 7.5 ...
-
bioRxiv - Microbiology 2019Quote: ... A 10 nM solution of biotinylated penta-His antibody (Qiagen) was incubated for 10 min on the neutravidin-coated surface and excess unbound antibody removed (22 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-Strep-tag II epitope mouse monoclonal antibody # 34850 (QIAGEN), anti-6xHis-tag mouse monoclonal antibody # H1029 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... were functionalized with biotinylated anti-5His antibodies (Qiagen, Valencia CA) and stored with continuous rotation at 4°C in BRB80 (80 mM PIPES ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: anti-STrEP-Tag (#34850, Qiagen), monoclonal anti-β-actin antibody (A5441 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We used Penta-His mouse monoclonal antibody (Qiagen, Qiagen #34660) at a 1:2000 dilution in 5% BSA in PBS-T buffer for 1 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We used Penta-His mouse monoclonal antibody (Qiagen, Qiagen #34660) at a 1:2000 dilution in 5% BSA in PBS-T buffer for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... blots were incubated with mouse monoclonal RGS-His antibody (Qiagen) diluted 1:1,000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested by centrifugation at 4°C followed by cell lysis/RNA extraction using RNEasy plus mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Cancer Biology 2021Quote: ... Inoculants from glycerol stocks or stab culture were cultured overnight in liquid LB at 37°C and plasmids were extracted using Plasmid miniprep kit (Qiagen). See Key Resources Table for shRNA identity ...
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Developmental Biology 2021Quote: ... The samples were incubated at 37 °C for 16 hours overnight and were in turn cleaned-up using the QIAquick PCR Purification kit (QIAGEN) and eluted with 40 μl of 50 °C water ...
-
bioRxiv - Genetics 2020Quote: ... Ligation was carried out overnight at 16°C followed by overnight cross-link removal with 20mg/ml Proteinase K (Qiagen). The samples were purified using phenol-chloroform and ethanol precipitated resulting in 3C libraries ...
-
bioRxiv - Microbiology 2019Quote: ... snap frozen on dry ice and stored at −80°C until RNA purification with the Qiagen AllPrep RNA/DNA kit (Qiagen). Immunoglobulin amplicon preparation ...
-
bioRxiv - Genomics 2020Quote: ... 25ng of the purified product was subjected to self-ligation at 16 °C overnight in a total volume of 50uls and column purified using Qiagen (Qiagen) PCR purification kit as per manufacturers recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Five colonies with the correct sized insert were inoculated into liquid LB supplemented with spectinomycin and chloramphenicol and grown overnight at 37°C for plasmid extraction using a QIAprep Spin Miniprep Kit (Qiagen). The plasmid constructs were confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets were resuspended in lysis buffer and stored at -80°C before DNA or total RNA extraction with the Genomic DNA Mini (Blood/Culture Cell) (Genesis) or mRNAeasy (Qiagen) kits ...
-
bioRxiv - Biophysics 2022Quote: ... Purified protein was diluted in PBS buffer (pH = 7.2) and the fluorescence intensity was recorded at 60 °C in the Rotor-Gene 6600 real-time PCR cycler (Qiagen) for 18 h ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Genomics 2020Quote: ... We stored tissue at 4 °C for 24-72 hours prior to extracting DNA with a DNAeasy Blood and Tissue Kit (Qiagen) with on-column RNase A treatment following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: Tissue samples were snap frozen in liquid Nitrogen and stored at −80 °C until genomic DNA (gDNA) was extracted using DNeasy blood and tissue kit (QIAGEN). Tissues were lysed in 360 µL of lysis solution on a Precellys 24 homogenizer for 30s at 4.0 ms−1 ...
-
bioRxiv - Microbiology 2019Quote: ... medium at 37°C and was made competent with rubidium chloride according to the method provided in the QIAexpressionist manual protocol 2 (Qiagen). When antibiotic selection was required ...
-
bioRxiv - Genomics 2019Quote: ... transposition was performed on 25,000 sorted tetraploid nuclei at 37°C for 30 minutes followed by DNA purification with the MinElute Reaction Cleanup Kit (28206, QIAGEN). DNA fragments were PCR preamplified for 5 cycles initially ...
-
bioRxiv - Neuroscience 2019Quote: ... EST plasmids were grown in Luria Bertani (LB) media overnight at 37°C and purified before further use (QIAprep Spin Miniprep Kit, Qiagen). Plasmids were linearized with PauI (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: ... After 16 hrs in a 37°C shaker bacteria were harvested and plasmid DNA was isolated using a Megaprep kit (Qiagen). ITR integrity was confirmed by digestion with XmaI as well as with AhdI ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cross-linking was reversed by incubation overnight at 65 °C and DNA was purified using a MinElute PCR purification kit (Qiagen). All IP DNA and 1 ng of input DNA were used for library preparation using the ThruPLEX-FD Prep Kit or ThruPLEX DNA-Seq (Rubicon Genomics) ...
-
bioRxiv - Developmental Biology 2020Quote: ... In vitro transcribed mRNAs were DNAse-treated using TURBO-DNAse for 15 min at 37°C and purified using the RNeasy Mini Kit (Qiagen) and quantifed using Qubit™ RNA BR Assay Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: The decellularized Balb/c mouse pancreas scaffolds were washed in PBS and homogenized-lysed for 1 hr in Tissue homozilyser II (Qiagen). The ECM proteins were dissolved in lysis buffer containing Tris HCl 0.06M ...
-
bioRxiv - Genetics 2019Quote: ... Crosslinking was then reversed by overnight incubation at 65°C and DNA purified using QIAquick PCR purification column (Qiagen, 28104). Immunoprecipitated DNA was then quantified via Qubit (ThermoFisher ...
-
bioRxiv - Systems Biology 2020Quote: ... cultures were harvested in RLT buffer and stored at −80°C before isolation of RNA using the RNeasy Mini Kit (Qiagen). mRNA was isolated from 1 ug total RNA by poly-dT enrichment using the NEBNext Polya ...
-
bioRxiv - Genetics 2019Quote: ... Cross-links were reversed at 65°C overnight (16 hrs) and DNA was purified using a PCR purification kit (Qiagen). DNA content was quantified by RT-PCR using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... 72 °C - 10 min) and amplicons separated using a Qiaxcel Advanced Separation System using 15 - 3000 bp markers (Qiagen, UK).