Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Resistant Starch Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The primers were designed using the PyroMark Assay Design Software 2.0 (Qiagen) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Mm_miR-29c were the miScript primer assays pre-designed by Qiagen. The mature microRNA sequences were 5’UAGCACCAUCUGAAAUCGGUUA for Mm_miR-29a ...
-
bioRxiv - Cancer Biology 2024Quote: ... For two-way qPCR (analysis of MAPK11; Hs_MAPK11_1_SG QuantiTect Primer Assay, Qiagen); cDNA was first synthesised with High Capacity cDNA Reverse Transcription Kit (Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For one-way qPCR (analysis of MAP3K1, Hs_MAP3K1_1_SG QuantiTect Primer Assay, Qiagen); Luna® Universal One-Step RT-qPCR Kit was used ...
-
bioRxiv - Neuroscience 2022Quote: Primers used for expression studies were purchased from Qiagen (QuantiTect Assays, Hilden. Germany): Ccl2 (QT00167832) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR and sequencing primers were designed using the PyroMark Assay Design software (Qiagen). All successfully amplified PCR products were analysed on a PyroMark Q24 (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: All assays were performed on a real-time PCR (Rotor Gene Q, Qiagen). PCR reactions were set-up using the complementary QIAgility robotic pipettor (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... and β2-microglobulin (B2M) mRNAs were performed using validated QuantiTect primer assays (Qiagen). B2M levels were used as an endogenous control for normalization ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Biochemistry 2021Quote: ... GAPDH transcripts were detected by RT2 qPCR Primer Assay (Qiagen, Cat# 330001 PPQ00249A) and the qPCRBIO SyGreen Mix Hi-ROX kit (PCRBIOSYSTEMS) ...
-
bioRxiv - Cell Biology 2021Quote: ... End-point PCR assays were performed with AllTaq Master Mix (Qiagen, Hilden, Germany), following manufacturer’s recommendations ...
-
bioRxiv - Pathology 2022Quote: ... The transgene was detected using RT2 qPCR Primer Assays from Qiagen (Venlo, Netherlands), and as a normalization gene we used (GAPDH or beta-actin) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA concentration was measured by the Qubit RNA BA assay (Qiagen [32852]). Information on samples from patients use in this study is included in Table 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or GAPDH (catalog no. QT00273322) as an endogenous control (Quantitect Primer Assay, Qiagen). Data analysis was performed with the QuantStudio 6 and 7 Flex Real-Time PCR System Software v1.0 (Applied Biosystems ...
-
bioRxiv - Biochemistry 2022Quote: ... GAPDH transcripts were detected by RT2 qPCR Primer Assay (Qiagen, Cat# 330001 PPQ00249A) and the qPCRBIO SyGreen Mix Hi-ROX kit (PCRBIOSYSTEMS) ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: ... defined by a positive QuantiFERON-TB Gold In-Tube (QFT+) assay (Qiagen, Germany), and 25 HIV-negative adults with TB disease (TB) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and qPCR was performed using gene specific QuantiTect Primer Assay primers from Qiagen. Relative expression levels were normalized to gapdh expression according to the formula <2^− (Ct gene of interest − Ct gapdh ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR and sequencing primers were designed by Pyromark Assay Design Software 2.0 (Qiagen) and available upon request ...
-
bioRxiv - Microbiology 2020Quote: ... who tested positive on QuantiFERON-TB Gold in tube assay (Qiagen, Hilden, Germany). All study participants were screened for T2D based on HbA1c ≥ 6.5% and random plasma glucose ≥ 200 mg/dL or a previous history of T2D ...
-
bioRxiv - Biochemistry 2021Quote: Assay mixes consisted of 25 nM ALEXA488-conjugated penta-His antibody (Qiagen # 35310), 50 μM DTT ...
-
bioRxiv - Cancer Biology 2020Quote: ... and internal control EIF3D and RPL13A specific primers (RT2 qPCR Primer Assays -Qiagen) and RT² SYBR® Green qPCR master mix using the recommended protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primer design was carried out using PyroMark Assay Design software (version 2.0, Qiagen). Pyrosequencing of biotinylated PCR products was performed using PyroMark Q48 Advanced CpG reagents (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primers used against DDIT3 (CHOP) were commercially available QuantiTect primer assays (Qiagen, UK). Please refer to table S2 and S3 in the supplementary material for the sequences of other primers used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The transcript levels of NOTCH3 were measured using QuantiTect primer assay (QT00003374, Qiagen), the sequences of the other targets are provided in Table 2 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Gene expression levels were analyzed using predesigned QuantiTect primer assays (Hs_GAPDH_1_SG: QT00079247 Qiagen, Hs_FPR1_1_SG ...
-
bioRxiv - Genomics 2019Quote: The RNA extraction kit (RNeasy Mini Kit, Qiagen) was used for the total RNA isolation ...
-
bioRxiv - Bioengineering 2020Quote: ... An RNA extraction kit (RNeasy extraction Kit, Qiagen) was used to purify RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription kits (RT2 First Strand Kit; Qiagen) were used for cDNA synthesis ...
-
bioRxiv - Microbiology 2019Quote: ... kit (Qiagen). Phylogenetic groups were determined as described in (Clermont ...
-
bioRxiv - Microbiology 2019Quote: ... Kit (QIAGEN) followed with 16S-ITS PCR as previously described (64 ...
-
bioRxiv - Genetics 2020Quote: ... Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Kit (Qiagen). Whole-genome sequencing was performed using the Illumina Nextera XT library protocols and sequenced at 2 x 300bp read length on the MiSeq platform (Ramaciotti Centre for Functional Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... Kit (Qiagen) using 5 mL culture of V_227 which was grown in MMT-YE medium (20°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The kits for RNA extraction were from Qiagen (RNeasy Mini Kit and RNeasy Micro Kit). The reverse transcription kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... These assays were run against cDNA replicates with the miRCURY SYBR Green Mastermix (Qiagen) on a Qiagen RotorGene Q qPCR instrument ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primers were designed by use of the Pyromark Assay Design Software package (Qiagen), and 10 CpG sites of the FOXP3 intron region were selected for quantitative DNA methylation analysis ...
-
bioRxiv - Developmental Biology 2022Quote: ... and miRNA qPCR was performed using miRCURY LNA miRNA PCR Assays (QIAGEN, Germantown, MD) in QuantStudio 6 Real-Time PCR cycler system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... All data were normalized to the housekeeping gene 18S (18S QuantiTect Primer Assay; Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Immunology 2023Quote: ... was performed in duplicates using predesigned primer sets (Quantitect Primer Assays, Qiagen, Germantown, MD). Relative mRNA expression between groups was analyzed by the delta-delta Ct method and normalized to housekeeping genes ...
-
bioRxiv - Genetics 2023Quote: ... with biotin-labeled methylation-specific primers designed with Pyromark Assay Design Software 2.0 (Qiagen). The primer sequences are shown in Supplemental Table S1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... resuspended in nuclease- free water and quantified using Qubit DNA Broad Range assay (Qiagen). The duplex ddPCR quantification assay was based on the co-amplification of two target genes each detected with specific Taqman probes ...
-
bioRxiv - Cell Biology 2024Quote: ... All qPCR assays were performed on Rotor-Gene Q thermocycler (Qiagen, Toronto, ON, Canada). The relative expression of mRNA and miRNA was normalized to ACTB and snRNA U6 ...
-
bioRxiv - Microbiology 2024Quote: The multiplex real-time qPCR assays were carried out in Rotor-Gene Q (Qiagen). A primer mix (200 µl ...
-
bioRxiv - Immunology 2024Quote: ... gapdh (Assay ID: Mm99999915_g1) on the Rotor-Gene Q real-time PCR cycler (Qiagen). Thermal cycling conditions included an initial denaturation step at 95°C for 10 min followed by 40 cycles of 95°C for 15s and 60°C for 1 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Using a commercial kit (QIAGEN DNeasy isolation kit #69506), DNA was isolated from a tissue punch taken from the external ear ...
-
bioRxiv - Microbiology 2023Quote: ... using a commercial kit (RT2 First Strand Kit, Qiagen). Quantification of transduction of EBECs and HBECs with the SARS-CoV-2 pseudovirus was determined by real-time qPCR (rt-PCR ...
-
bioRxiv - Microbiology 2023Quote: ... and the RNeasy kit plus Mini kit (#74134, Qiagen) or using NucleoSpin RNA Plus XS ...