Labshake search
Citations for Qiagen :
451 - 500 of 1370 citations for Recombinant Mouse Dickkopf Homolog 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... HIS-fused p300 was expressed from pFastBac1 vector in High-Five cells and purified on Ni-NTA agarose beads (Qiagen, 30210) in BC buffer (20 mM HEPES pH7.9 ...
-
bioRxiv - Molecular Biology 2020Quote: Purified recombinant poly-histidine protein was obtained by FPLC under native conditions using a Ni-NTA column (Qiagen), and a Biologic DUO-FLOW BIO-RAD chromatography system (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: The recombinant plasmid DNA derived from positive clones was isolated by using the QIAGEN plasmid mini kit (QIAGEN) and digested by PmlI (vector PFLD ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant proteins NHis6-Fnr1 and Fnr3-CHis6 in the supernatant were purified on Ni2-NTA resin (Qiagen, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... filtered and the secreted recombinant proteins were purified by affinity chromatography using Ni-NTA resin (Qiagen; Cat.# 30230). Specifically ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were collected by centrifugation and the recombinant protein was column-purified using Ni2+-NTA resin (Qiagen). The purified protein was stored at -80°C ...
-
bioRxiv - Microbiology 2023Quote: ... second and 10th passage in ECE of recombinant NDV_GRABV using the QIAamp® Viral RNA Mini Kit (Qiagen). Genomic regions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tag fusions were purified by incubating the bacterial soluble fraction with pre-equilibrated Ni-NTA agarose bead slurry (Qiagen, Hilden, Germany) for 1 hour at 4°C and eluting with 500 mM imidazole ...
-
bioRxiv - Biochemistry 2020Quote: ... and the recombinant protein was purified by gravity-flow chromatography using a nickel-charged resin Ni-NTA Agarose (QIAgen) equilibrated with 10 mM imidazole in the lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were lysed and recombinant proteins were purified under native conditions using the Ni-NTA Fast Start Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The pulldown protocol was based on the principle of immobilization of recombinant protein using Ni-NTA agarose resin (Qiagen). The experiments were performed in biological triplicates and designed to contain 4 control samples (resin Ni-NTA with i ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol and 1 mM DTT) and recombinant TrcP was purified from clarified lysates using Ni-NTA resin (Qiagen) and gravity chromatography ...
-
bioRxiv - Cancer Biology 2021Quote: ... All recombinant vectors were grown in XL1-Blue competent cells and extracted using QIAprep Spin Miniprep kit (Qiagen, Germany) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant proteins were purified to near homogeneity (>95%) using Ni-chelate affinity chromatography on Ni-NTA Superflow resin (Qiagen) using standard protocols ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were then stained by Coomassie-blue or immunodetected as described before [26] using primary polyclonal antibodies directed against His6 epitope-tag (Penta His, Qiagen, dilution 1:1000), V5 epitope-tag (Bethyl Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...