Labshake search
Citations for Qiagen :
301 - 350 of 1230 citations for Recombinant Mouse Cd79a protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... adherent cells were collected and either analyzed by FC or subjected to RNA isolation using the RNeasy Mini Kit (Qiagen #74106).
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The expression construct was transformed into DH10MultiBacY cells and recombinant bacmid was purified with a QIAprep Spin Miniprep Kit (Qiagen). V0 and V1 virus generation was performed using SF9 cells as previously described 44 ...
-
bioRxiv - Cell Biology 2021Quote: ... The lysate was cleared via centrifugation and recombinant PfCen3-6xHis were purified from the soluble fraction using Ni-NTA agarose beads (QiaGen) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... cells were either left untreated or treated with 1000 IU/ml recombinant IFN-α treatment and incubated for 6 h or transfected overnight with polyI:C (10 μg/ml) using Polyfect (Qiagen). Luciferase assays were carried out ...
-
bioRxiv - Molecular Biology 2023Quote: ... the large stocks of recombinant T/F LTR-pGL3 reporter plasmids were generated using Plasmid Maxi kit (Qiagen, Valencia, CA) for immediate use or longer storage at -80 °C.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Molecular Biology 2023Quote: Total proteins from P5 hippocampi were purified with AllPrep DNA/RNA/Protein Mini Kit (Qiagen, 80004). The protein pellets were then resuspended in 90 μl Buffer ALO (Qiagen ...
-
bioRxiv - Physiology 2022Quote: ... Mouse Obesity (PAMM- 017ZC-12) array and Mouse Aging (PAMM-178ZC) from Qiagen (Maryland, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... protein was extracted (Qiagen Tissue Lyser) from ∼50 mg frozen liver in tissue lysis buffer 80 ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL Protein Precipitation Solution (QIAGEN) was added ...
-
bioRxiv - Cancer Biology 2023Quote: Advanced Protein Purification buffer (APP; Qiagen): the APP buffer contains zinc chloride to precipitate protein at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and The Protein Complex Suite (Qiagen). One microliter of 4.6 mg/ml protein sample suspended in crystallization buffer (25 mM Tris-HCl ...
-
bioRxiv - Genomics 2020Quote: ... Realtime-qPCR was performed on 11 differentially expressed (DE) miRNAs based on miRNA-seq results (|FC| ≥ 2, P < 0.05) using miScript SYBR Green PCR Kit (Qiagen 218073, California, USA) according to the manufacturer’s instructions with StepOne Applied Biosystems real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... 750ng of the gDNA was labeled using DLE-1 enzyme and reaction mix followed by Proteinase K digestion (Qiagen). The DNA back bone was stained after drop dialysis ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-sense DIG-labeled RNA probes were generated by in vitro transcription and purified with the RNeasy kit (Qiagen). At 55-62°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... washed twice in PBS and DNA was labeled with propidium iodide (50 μg/ml) in presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.1%) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA was labeled with propidium iodide (50 μg/ml) in the presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.01% ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted from the allantoic fluid of recombinant and wild type after the first and fifth passages in eggs using the QIAamp® Viral RNA Mini Kit (Qiagen). The real-time qRT-PCR was performed using SuperScript™ III Platinum™ One-Step qRT-PCR Kit to detect NDV M gene41 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The recombinant plasmid was then purified at a high concentration (200 μg/mL) using the plasmid preparation kit (Qiagen, Germantown, MD).
-
bioRxiv - Immunology 2024Quote: ... Genomic DNA from the pooled recombinants and parent strain were isolated using the Gentra® Puregene® DNA isolation kit (Qiagen) and sent for whole genome sequencing (BGI) ...
-
bioRxiv - Genomics 2019Quote: ... genomic DNA and protein using AllPrep DNA/RNA/Protein Mini Kit according to the manufacturer’s instructions (Qiagen). Stable and Dox-inducible expression cell line was generated by transfecting the indicated PiggyBac vectors in the presence of hyperactive transposase plasmid (hyPBase ...
-
bioRxiv - Neuroscience 2020Quote: ... total RNA and proteins were recovered by using the Allprep DNA/RNA/Protein Mini Kit (Qiagen 80004). The efficiency of Cre-induced recombination in Appflox/flox mice was verified by PCR with primers F ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein and RNA extraction was done using Qiagen AllPrep DNA/RNA/Protein isolation kit (Qiagen Inc, USA). RNA purity was confirmed with 260/280 OD ratio using Nanodrop reader (Thermo Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... some samples were lysed for total protein extraction using Qproteome Mammalian Protein Prep Kit (Qiagen, Hilden, Germany). Western blot was done using capillary electrophoresis based system Wes™ (ProteinSimple ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of mouse Donson was amplified from XpressRef Universal Total mouse RNA (QIAGEN, 338114) by RT-PCR (Takara ...
-
bioRxiv - Immunology 2019Quote: ... StrEP-Tag (mouse monoclonal, Qiagen, #34850). Peroxidase-conjugated secondary antibodies against rabbit IgG (#7074 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-His (Qiagen, number 34660); Mouse anti-β-actin (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Strep (Qiagen, Cat# 34850), and mouse anti-Histidine (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (LNA oligonucleotides targeting FLAP X and FLAP Y labeled with TYE 563, Qiagen) were pre-hybridized in either 100μL of 1X SSC for conventional smiFISH ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng DNA was random prime labeled (ENZO) with Cy3 (Sample DNA) or Cy5 (Input DNA) and purified on a MinElute PCR purification column (Qiagen). Labeled DNA was diluted in hybridization buffer (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (TYE 563 labeled LNA oligonucleotides targeting FLAP X and FLAP Y, Qiagen) were pre-hybridized in 100 μL of the following buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... were amplified using biotin-labeled primers (Supplementary Table 2) synthesized by Sangon Biotech (Shanghai, China) and purified by a PCR purification kit (Qiagen). The EMSA was conducted as described previously(An et al. ...
-
bioRxiv - Microbiology 2020Quote: ... and a portion of the tissue (0.08-0.3g) was placed into pre-labeled microcentrifuge tubes containing 5 mm stainless steel beads (Qiagen Inc., CA). Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... SiCBL4 and SiCBL7 promoters were respectively amplified using biotin-labeled primers (Table S1) synthesized by Sangon Biotech (Shanghai China) and purified using a PCR purification kit (Qiagen). EMSA was conducted using a LightShift Chemilumniescent EMSA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Then this amplified product was labeled with biotin at 5’ end followed by purification using the Qiaquick nucleotide removal kit (QIAGEN).To check the drug-protein interaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digoxigenin-labeled LNA probes against mito-tRNA Asn and nuclear-encoded tRNA Asn designed by Qiagen (sequences in supplementary methods) were boiled for 2 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins from HGCC cells and GBM tissue were extracted with the AllPrep DNA/RNA/Protein Mini Kit (Qiagen).
-
bioRxiv - Neuroscience 2019Quote: ... RNA and protein were extracted for ECM composition analysis using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). RNA was processed with the QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2019Quote: ... To summarize the cellular locations and protein classes the protein list was annotated using Ingenuity Pathway Analysis (Qiagen).
-
bioRxiv - Microbiology 2020Quote: The RNA genomes of recombinant MeV in P2 or P10 were isolated from infected Vero cells using the QIAamp Viral RNA Mini Kit (QIAgen, Hilden, Germany) according to the manufacturer’s instructions and resuspended in 50 μL RNase-free water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 250 μl of Protein Precipitation Solution (QIAGEN) was added to each sample and were incubated on ice for 5 min followed by vigorous vortexing for at least 30 sec ...
-
bioRxiv - Molecular Biology 2021Quote: ... For protein purification Ni-NTA agarose (Qiagen) was used ...
-
bioRxiv - Genomics 2020Quote: ... 333 μL of Protein Precipitation Solution (Qiagen) was added to each sample which was then vortexed and then centrifuged at 2000 x g for 10 minutes ...