Labshake search
Citations for Qiagen :
351 - 400 of 1325 citations for Recombinant Human ROR1 protein His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Labeled cRNA was purified using RNeasy Mini Spin Columns (Qiagen) and eluted in 30 μl of nuclease-free water ...
-
bioRxiv - Cancer Biology 2024Quote: ... The nick-labeled sample was treated with proteinase K (QIAGEN) at 50°C for 30 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 200nM siRNA/well were used for transfection using 5µl/well of Hi-Perfect (Qiagen) following manufacturer’s recommendation.
-
bioRxiv - Biophysics 2021Quote: ... coli and purified by His-tag affinity purification using Ni-NTA agarose beads (Qiagen) followed by ion exchange purification using a mono-Q HR 5/5 column (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Biochemistry 2021Quote: ... Blots were probed with antibodies against His6 (penta-His Qiagen catalog #34460; 1:10,000), FLAG2 (Sigma catalog #A8592 ...
-
bioRxiv - Plant Biology 2022Quote: ... Blocking of the membranes was performed in anti His HRP conjugate blocking buffer (Qiagen). After blocking at room temperature for 2 h ...
-
bioRxiv - Microbiology 2022Quote: ... After incubation with the primary antibody from QIAGEN (Penta-His Antibody, 1:1000 dilution) at RT for 1 h under shaking ...
-
bioRxiv - Cell Biology 2020Quote: ... the resolubilized histidine-tagged histones were purified with Ni affinity chromatography using Ni-NTA beads (Qiagen). For untagged H2B ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant containing the polyhistidine-tagged toxin was loaded onto a Ni-NTA agarose column (Qiagen). The column was then washed with a 20–120 mM gradient of imidazole to remove additional contaminating proteins ...
-
bioRxiv - Genomics 2019Quote: ... Lysates were washed twice with 650 µL of PE buffer (Qiagen) and spun through the columns at 6000 rpm for 1 minute ...
-
bioRxiv - Bioengineering 2023Quote: ... Recombinant plasmids were prepared by using the QIAprep Spin Miniprep Kit (QIAGEN) and confirmed by sequencing analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene of interest (GOI) siRNA or control siRNA were incubated at room temperature with Enhancer R and Buffer EC-R (Qiagen, USA) for 20 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 100 ng/well of mouse anti-Penta His BSA-free antibody (Qiagen) in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... a 1:2000 dilution of a mouse anti-Penta-His Alexa Fluor 647 conjugate (Qiagen) was used.
-
bioRxiv - Biochemistry 2021Quote: ... Monoclonal mouse anti-StrepII and anti-His antibodies were obtained from QIAGEN (catalog number 34850) and Genscript (catalog number A00186) ...
-
bioRxiv - Microbiology 2022Quote: ... BapR-CPD-His was affinity purified from cleared lysates using Ni-NTA agarose beads (Qiagen) with gentle rocking at 4°C for 2 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... containing an N-terminal His-tag was removed on a Ni-NTA agarose column (Qiagen). Proteins were additionally purified through a Superdex 200 26/60 size exclusion column (Pharmacia Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... MCP (His-HaloTag-2xMCP) was purified using its histidine tag with Ni-NTA Agarose (Qiagen) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Immunology 2022Quote: ... after which the cells were stained with anti-Penta-His-AF647 (1 µg/mL; Qiagen) for 30 minutes at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... the precipitates were subjected to Western blot analysis with anti-penta-His (1:2000, Qiagen) and anti-FLAG M2 (1:4000 ...
-
bioRxiv - Microbiology 2023Quote: ... and were probed with either horseradish peroxidase (HRP)- conjugated primary antibodies against His-tag (Qiagen) or with rabbit primary antibodies against HA-tag (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... His-tag-affinity chromatography-purifcation was performed with a Ni-NTA agarose (Qiagen, Hilden, Germany) gravity flow column ...
-
bioRxiv - Microbiology 2020Quote: ... Gravity column was used for purification with His6-tagged Mpro binding to Ni-NTA beads (Qiagen 30210), washed with lysis buffer + 10mM imidazole and eluted with increasing concentration of imidazole (50mM ...
-
bioRxiv - Biochemistry 2023Quote: ... His6-tagged cleavage products as well as TEV protease were removed with Ni-NTA agarose resin (Qiagen) on gravity flow disposable plastic columns ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... Labeled cRNA was purified using an RNeasy Mini kit (Qiagen GmbH). The concentration and specific activity of the labeled cRNAs (pmol Cy3/μg cRNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antisense LNA GapmeRs (custom designed, 3’-FAM-labeled, Qiagen, Table S5) were bilaterally microinfused using a 2 μl calibrated micropipette (Hamilton syringes ga 25/70mm/pst3) ...
-
bioRxiv - Biophysics 2023Quote: ... Labeled oligos were purified with QIAquick nucleotide removal kit (Qiagen; #28304) and used as reverse transcription primers.
-
bioRxiv - Neuroscience 2023Quote: ... labeled CPN or CThPN somata were sorted into RLT buffer (Qiagen) supplemented with 10% b-Mercaptoethanol using a customized SORP FACSAriaII (BD Instruments ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplified DNA was cleaned using PB and PE buffers (Qiagen 28006). Concentration and molarity (nmol/L ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the column was washed by addition of 400 µL buffer PE (Qiagen) followed by centrifugation and discarding the flow-through ...
-
bioRxiv - Microbiology 2023Quote: ... under p32 promoter to the recombinant expression using PCR Cloning Kit (Qiagen, Germany). The recombinant plasmids were named as pMG36e:nisA (nisA) ...
-
bioRxiv - Microbiology 2020Quote: ... BipA-His was purified from the soluble fraction by affinity chromatography using Ni-NTA agarose (QIAGEN) previously equilibrated with equilibration buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6x-His-Smt3 was purified from BL21 E.coli cells using a Ni-NTA affinity column (Qiagen) following manufacturer indications ...
-
bioRxiv - Cancer Biology 2021Quote: ... Signal was detected using mouse anti-His antibody from Qiagen (Cat No./ID: 34660 1:500). Anti-mouse HRP was used for colorimetric development (Cat No./ID-A8924 1:1000) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 nM siRNA/well were used for transfection using 0.8 µl/well of Hi-Perfect (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.
-
bioRxiv - Cell Biology 2020Quote: 6xHis-tagged GFP-Fis and GFP-NusA were expressed from pCA24N and purified using Ni-NTA resin (Qiagen) in a gravity-flow column at 4°C as described (Kitagawa 2005) ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA of cells expressing M13-tagged RNA was isolated using an RNeasy Mini Kit (QIAGEN, Venlo, Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The labeled cDNAs were purified with a QIAquick PCR purification kit (Qiagen). DNA microarrays were processed and analyzed as previously described [59] ...
-
bioRxiv - Genomics 2020Quote: ... Labeled PCR product was purified with a QIAquick PCR Purification Kit (QIAGEN) and 50ng was mixed with hybridization buffer ...