Labshake search
Citations for Qiagen :
301 - 350 of 527 citations for Recombinant Human PLAT None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Human rRNA depletion was performed using the QIASeq FastSelect kit (Qiagen, Hilden, Germany). RNA sequencing library preparation used NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s recommendations (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: DNA from human stool samples was extracted with DNeasy PowerSoil Pro kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total RNA for human TSCs was extracted using RNeasy Micro kit (Qiagen, 74004) with on-column DNase digestion ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or primary human cells were extracted using the Qiagen RNeasy Micro Kit (Qiagen). cDNA was produced using the SuperScript IV VILO cDNA Synthesis Kit (Thermo Fisher) ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Genetics 2021Quote: Human genomic DNA (gDNA) was extracted using the QIAamp DNA Mini Kit (QIAGEN, Germany) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... pallidum and human RNase P gene (RNP) using a Rotor-Gene 6000 instrument (Qiagen) as previously described with modifications (11 ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Immunology 2021Quote: ... total RNA of CD8+ human T cells was extracted by miRNeasy Mini Kit (Qiagen), following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and human islets were isolated using RNeasy Mini or Micro kits (Qiagen; Valencia, CA). Reverse transcription was completed with a High Capacity cDNA Reverse Transcription kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... rodent tissues and human samples using the Qiagen Blood and Tissue Kit (Qiagen, USA). The procedures prior to protein digestion were as follows ...
-
bioRxiv - Neuroscience 2022Quote: Cultured human T cells after treatment were flash frozen in Buffer RLT (Qiagen, 79216) and kept in −80°C until processing ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA from cultured human cells were isolated using the QIAamp DNA kit (Qiagen) and genomic DNA from MEFs and mouse tissue samples were extracted using the DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from human cells with an RNA purification kit (Qiagen, 74134) and genomic DNA was removed by genomic DNA binding columns in the kit ...
-
bioRxiv - Genomics 2019Quote: Dissociated human islets cells were transfected with scramble siRNA (Cat# 1027284, Qiagen, Toronto, Canada) or siRNA from ThermoFisher Scientific against OGDHL (ID# s31422) ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total RNA was extracted from cultured human ECs using a RNeasy Mini kit (Qiagen). For reverse transcription ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or human ABCB1-transfected MDR-19 cells using the RNeasy Mini extraction kit (Qiagen). First strand cDNA synthesis was performed on 500 ng of template RNA using MMLV reverse transcriptase (fc 10 units/µl) ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: Bacterial and human cells were treated with RNAprotect cell or bacterial reagent (Qiagen, Germany) and stored at -80°C for up to 1 week ...
-
bioRxiv - Neuroscience 2023Quote: Transfected iPSC-OPCs and post-mortem human MS samples were lysed in Qiazol (Qiagen), and RNA was isolated using a standard chloroform extraction and ethanol precipitation method ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from human islets using the miRNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from human cells using RNeasy Mini kits (QIAGEN, Hilden, Germany) and reverse transcribed using Super-Script III (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Genomics 2024Quote: ... genomic DNA from human primary T cells was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...