Labshake search
Citations for Qiagen :
351 - 400 of 2144 citations for Recombinant Human Neuropilin 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids from transformants were isolated using the QIAprep® Spin Miniprep Kit (Qiagen) and sequence-verified via Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids from transformants were isolated using the QIAprep® Spin Miniprep Kit (Qiagen) and sequence verified via Sanger sequencing (Microsynth ...
-
bioRxiv - Immunology 2021Quote: ... and recombinant proteins produced in the supernatant were purified using Ni-NTA agarose (QIAGEN). To biotinylate RBD proteins ...
-
bioRxiv - Cell Biology 2022Quote: Constructs for recombinant bacterial protein expression were all cloned in the pQE plasmid (Qiagen). Su9-DHFR and CaM-3C-Alfa-Sec61β(2–60)-OMP25(112–145)F128Amber were cloned downstream of a His14-bdSUMO tag ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were purified according to manufacturer’s instructions by Ni2+-NTA agarose beads (QIAGEN). Washing steps were performed with a buffer containing 20 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 mM imidazole and the recombinant V0c was purified over Ni-NTA beads (QIAGEN).
-
bioRxiv - Microbiology 2023Quote: ... The recombinant plasmid was purified using QIAgen mini prep kit (cat no.27106, Qiagen) as per manufacture’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant plasmids were extracted by using the EndoFree Plasmid Maxi Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The JAK3 PCR fragment was purified and cloned into the pQE-Tri System His-Strep2 vector (Qiagen). The final pQE-JAK3 construct was used to transfect GC using the Xfect transfection kit (Takara Bio ...
-
bioRxiv - Microbiology 2019Quote: ... and Western blot analysis was performed as previously described (30) using a primary anti-his antibody (Qiagen) and a secondary Alexa Fluor 700 goat anti-mouse antibody ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plates were coated with 100 μL of 4 μg/mL murine anti-His mAb (Qiagen, #34660), and after blocking ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... 0.2 µg of AFP1-His proteins was incubated with 20 µl Ni-NTA agarose beads (Qiagen, Germany) in buffer (25 mM Tris-Cl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein bands were transferred to a nitrocellulose membrane and probed with primary antibodies [mouse anti-His (Qiagen) to detect CAT ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a TEV cleavable N-terminal His-tag were purified using Ni-NTA agarose (Qiagen) resin and were treated to gel filtration using a Superose 6 Increase 16/600 column or Superdex 200 Hiload 16/600 column (Cytiva ...
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... mito-roGFP and Myc-epitope-tagged murine Serpin E13,22,23 were purified with Plasmid Plus Midi columns (Qiagen, Inc., Germantown, MD) and administered to 6–8-week-old FVB mice via HDTVI (10 μg each ...
-
bioRxiv - Biochemistry 2022Quote: ... Metal-chelate affinity chromatography was used to purify the 6xHis-tagged proteins using the Ni-NTA Fast Start Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 350 µl of 100% ethanol was added to the tube (“TRAP” fraction: enriched in transcriptome associated to EGFP-tagged ribosomes) and then loaded onto a RNeasy MinElute column (Qiagen). RNA was isolated using RNeasy Mini Kit (#74104 ...
-
bioRxiv - Bioengineering 2021Quote: ... The histidine-tagged TEV and MBP were extracted from the solution using a Ni-NTA agarose resin (Qiagen, Hilden, Germany) as described in[20].
-
bioRxiv - Biophysics 2020Quote: ... Cells were transiently transfected with cDNA encoding the mouse Piezo1 channel or its mutants tagged with GFP on its N-terminus in the pCDNA3 vector using the Effectene reagent (QIAGEN). Cells were then trypsinized and re-plated on poly-D-lysine-coated round coverslips 24 hours after transfection ...
-
bioRxiv - Developmental Biology 2020Quote: ... at a density of 1-2×106 cells/ml and transfected with pRmHA3-GAL4 [60] and HA-tagged p10UAST-Robo or untagged pUAST-Slit plasmids using Effectene transfection reagent (Qiagen). GAL4 expression was induced with 0.5 mM CuSO4 for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... 50% confluent HEK 293T cells were transfected with 6000 ng GFP-tagged RhCMV gH-CD4 TM plasmid using Effectene Transfection Reagent Kit (Qiagen) next day ...
-
bioRxiv - Developmental Biology 2023Quote: ... at a density of 1-2×106 cells/ml and transfected with pRmHA3-GAL4 (Klueg et al., 2002) and HA-tagged p10UAST-Robo or untagged pUAST-Slit plasmids using Effectene transfection reagent (Qiagen). GAL4 expression was induced with 0.5 mM CuSO4 for 24 hours ...
-
bioRxiv - Developmental Biology 2023Quote: Immunoprecipitation against HA-tagged exosomes was performed using Abcam Immunoprecipitation protocol on pan-exosomes isolated using the exoEasy kit (Qiagen). Protein G beads (Thermo Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... a second transfection of a 0.6 μg plasmid encoding either the C-terminal GFP11 tagged M2tail(368-466) or M2 receptor was performed using the Effectene Transfection Reagent (Qiagen). After washing each well with 2 mL PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... and the recombinant protein was purified on Ni-NTA agarose following the manfacturer’s instructions (Qiagen). The eluate (3x 500 μl ...
-
bioRxiv - Immunology 2020Quote: ... The linearized recombinant gDNA was transfected into 293 cells using the PolyFect Transfection Reagent (Qiagen). After virus rescue was observed via plaque formation ...
-
bioRxiv - Microbiology 2019Quote: ... The recombinant Lsr2 proteins were purified using immobilized-metal affinity chromatography (Ni-NTA agarose, Qiagen) and size exclusion chromatography ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Recombinant Fab proteins were purified from the culture supernatant by nickel-nitrilotriacetic acid agarose (Qiagen). Recombinant mAbs were affinity purified by MabSelect resin (Cytiva ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All recombinant DNA was isolated and purified through Miniprep kits according to manufacturer’s instructions (Qiagen). Sequences were confirmed by Sanger sequencing.
-
bioRxiv - Biochemistry 2020Quote: ... DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... (2010) using commercial antibodies directed against the His-tag following the instructions of the manufacture (Qiagen, Hilden, Germany).
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 RBD-His protein was purified from cell culture supernatant using a Ni-NTA (Qiagen) affinity column ...
-
bioRxiv - Biochemistry 2019Quote: ... DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... His-SFP1 was purified using Ni-NTA affinity purification under native conditions using the standard manufacturer’s protocol (Qiagen). Recombinant His-SFP1 was used to immunize female New Zealand white rabbits (Covalab ...
-
bioRxiv - Biochemistry 2021Quote: DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Plant Biology 2024Quote: ... All fractions were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using anti-His (Qiagen) and anti-strep (MilliporeSigma ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2022Quote: ... HT-1080 cells and the g2-41 Gp78 CRISPR/Cas9 knockout clones were stably transfected with mRFP-GFP tandem fluorescent-tagged LC3 (tfLC3) plasmid using Effectene (Cat. #301425, Qiagen, USA) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... The soluble 6His-tagged proteins were purified from the supernatant by affinity chromatography using Ni2+-NTA agarose resin (Qiagen, Hilden, Germany). After several washing steps ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids containing a tagged gene of interest were transfected into Drosophila S2 cells using Effectene transfection reagent following the manufacturer supplied protocol (Qiagen 301425). S2 cells were passaged 24h before transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... Cat# 28-9537- 66) was used and Streptavidin tagged proteins were purified using Strep-Tactin® Superflow® Plus cartridge (QIAGEN). Columns were attached to MINIPULS® 3 peristaltic pump (Gilson ...
-
bioRxiv - Biophysics 2021Quote: ... gliding motility assays were performed with specific immobilization of motors on the surface via penta-His antibodies (34660, Qiagen) as previously described[64] (Figure S4) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Renilla-HA-NOD2 (750 ng/well) and His-FLAG-CAD (250 ng/well) using Effectene Transfection Reagent (Qiagen). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP ± MirA was loaded onto a column with 80 µL of previously equilibrated Ni-NTA resin (Qiagen) and incubated for 1 h at 4°C with agitation ...
-
bioRxiv - Molecular Biology 2022Quote: His-Prs or its variants (10 µg) were bound to 4 µl of Ni-NTA Magnetic Agarose Beads (Qiagen) in 50 µl interaction buffer (50 mM Tris pH 9.0 ...