Labshake search
Citations for Qiagen :
451 - 500 of 1658 citations for Recombinant Human Lipocalin 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... filtered and the secreted recombinant proteins were purified by affinity chromatography using Ni-NTA resin (Qiagen; Cat.# 30230). Specifically ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were collected by centrifugation and the recombinant protein was column-purified using Ni2+-NTA resin (Qiagen). The purified protein was stored at -80°C ...
-
bioRxiv - Microbiology 2023Quote: ... second and 10th passage in ECE of recombinant NDV_GRABV using the QIAamp® Viral RNA Mini Kit (Qiagen). Genomic regions ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tag fusions were purified by incubating the bacterial soluble fraction with pre-equilibrated Ni-NTA agarose bead slurry (Qiagen, Hilden, Germany) for 1 hour at 4°C and eluting with 500 mM imidazole ...
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from human samples was extracted with PowerSoil Pro (Qiagen) on the QiaCube HT (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... the human Stress & Toxicity PathwayFinder RT2 Profiler™ technology (Qiagen), assessing expression of 84 stress response-related genes ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and the recombinant protein was purified by gravity-flow chromatography using a nickel-charged resin Ni-NTA Agarose (QIAgen) equilibrated with 10 mM imidazole in the lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were lysed and recombinant proteins were purified under native conditions using the Ni-NTA Fast Start Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The pulldown protocol was based on the principle of immobilization of recombinant protein using Ni-NTA agarose resin (Qiagen). The experiments were performed in biological triplicates and designed to contain 4 control samples (resin Ni-NTA with i ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol and 1 mM DTT) and recombinant TrcP was purified from clarified lysates using Ni-NTA resin (Qiagen) and gravity chromatography ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant plasmids for mouse vaccination were prepared using an EndoFree Plasmid Purification Kit (Cat# 12391, Qiagen, Hilden, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... All recombinant vectors were grown in XL1-Blue competent cells and extracted using QIAprep Spin Miniprep kit (Qiagen, Germany) according to manufacturer instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant proteins were purified to near homogeneity (>95%) using Ni-chelate affinity chromatography on Ni-NTA Superflow resin (Qiagen) using standard protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were then stained by Coomassie-blue or immunodetected as described before [26] using primary polyclonal antibodies directed against His6 epitope-tag (Penta His, Qiagen, dilution 1:1000), V5 epitope-tag (Bethyl Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The expression construct was transformed into DH10MultiBacY cells and recombinant bacmid was purified with a QIAprep Spin Miniprep Kit (Qiagen). V0 and V1 virus generation was performed using SF9 cells as previously described 44 ...
-
bioRxiv - Cell Biology 2021Quote: ... The lysate was cleared via centrifugation and recombinant PfCen3-6xHis were purified from the soluble fraction using Ni-NTA agarose beads (QiaGen) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... 6XHis tagged-Trx1 and Trr1 recombinant proteins were cloned in PET24 vectors and purified by column affinity onto Ni-NTA beads (Qiagen). The precursor was imported in 50 μg of the indicated yeast mitochondria in the presence of 2 mM ATP and 2.5 mM NADH at 30°C ...
-
bioRxiv - Microbiology 2020Quote: ... cells were either left untreated or treated with 1000 IU/ml recombinant IFN-α treatment and incubated for 6 h or transfected overnight with polyI:C (10 μg/ml) using Polyfect (Qiagen). Luciferase assays were carried out ...
-
bioRxiv - Molecular Biology 2023Quote: ... the large stocks of recombinant T/F LTR-pGL3 reporter plasmids were generated using Plasmid Maxi kit (Qiagen, Valencia, CA) for immediate use or longer storage at -80 °C.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Biophysics 2023Quote: ... coli strain M15-[pREP4] (for transformation of recombinant plasmids) and RNAse (for protein purification) were purchased from Qiagen (Valencia, CA). All other chemicals were obtained from Sigma-Aldrich (St ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant protein was partially purified by affinity chromatography on nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com). Purification steps were carried out as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted from the allantoic fluid of recombinant and wild type after the first and fifth passages in eggs using the QIAamp® Viral RNA Mini Kit (Qiagen). The real-time qRT-PCR was performed using SuperScript™ III Platinum™ One-Step qRT-PCR Kit to detect NDV M gene41 ...
-
bioRxiv - Biophysics 2020Quote: ... Bacterial extracts were prepared as described46 and the recombinant protein was purified using an Ni-NTA Superflow cartridge (Qiagen, Hilden, Germany) and eluted with imidazol47 ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid was transfected to 293T cells and the recombinant S protein trimers were purified by Ni-NTA (nickel-nitrilotriacetic acid) chromatography (QIAGEN, Germany), followed by size exclusion to further purify the trimers ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The recombinant plasmid was then purified at a high concentration (200 μg/mL) using the plasmid preparation kit (Qiagen, Germantown, MD).
-
bioRxiv - Immunology 2024Quote: ... Genomic DNA from the pooled recombinants and parent strain were isolated using the Gentra® Puregene® DNA isolation kit (Qiagen) and sent for whole genome sequencing (BGI) ...
-
bioRxiv - Genetics 2022Quote: RNA from human ileal biopsies was extracted using RNeasy Mini Kit (Qiagen). 500 ng of RNA was reverse transcribed to cDNA using TaqMan Reverse Transcription kit (#N8080234 ...
-
bioRxiv - Cell Biology 2022Quote: FASTQ files generated by sequencing human macrophages were imported into ArrayStudio (Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were applied to the Human Aging RT2 Profiler PCR arrays (Qiagen) and run on Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Molecular Biology 2019Quote: Human islet RNA was extracted using the Qiagen RNeasy Kit (Qiagen; #74106) according to manufacturer’s instructions ...