Labshake search
Citations for Qiagen :
501 - 550 of 1271 citations for Recombinant Human GPC3 protein His tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The eluted 4sU-labeled RNA and reserved total RNA were purified with the miRNeasy Micro kit (Qiagen) according to the manufacturer’s protocol with on-column DNase I treatment ...
-
bioRxiv - Biophysics 2023Quote: ... Nap1 FL was also labeled with XFD488 in 1:4 molar ratio after nickel affinity purification (Qiagen) and further purified with anion exchange and size exclusion chromatography (Cytiva) ...
-
bioRxiv - Genomics 2020Quote: ... Protein was precipitated by adding 200 µL of ice-cold Protein Precipitation Solution (Qiagen), gentle mixing and incubation on ice for 10 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The peptide-coupled proteins were separated from uncoupled proteins using Ni-NTA Agarose (Qiagen).
-
bioRxiv - Neuroscience 2020Quote: ... Total protein was extracted using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen #80004) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total protein was purified by the AllPrep DNA/RNA/Protein Mini Kit (Qiagen: # 80004). Corresponding protein expression levels in the cells of different groups were detected by western blot using the following antibodies ...
-
bioRxiv - Cell Biology 2023Quote: Cells were harvested for total protein using a Qproteome Mammalian Protein Prep Kit (Qiagen). Total protein was quantified using a PierceTM BCA Protein Assay Kit (Cat ...
-
bioRxiv - Bioengineering 2020Quote: ... The RBD wildtype and mutant proteins of SARS-CoV-2 spike with 10×his tag at N terminal were expressed in HEK 293 and purified with Ni-NTA affinity columns (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tag fusions were purified by incubating the bacterial soluble fraction with pre-equilibrated Ni-NTA agarose bead slurry (Qiagen, Hilden, Germany) for 1 hour at 4°C and eluting with 500 mM imidazole ...
-
bioRxiv - Developmental Biology 2022Quote: ... 333µl Protein Precipitation Solution (Qiagen) was added and samples were vortexed vigorously for 20 seconds at high speed ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein Precipitation Solution (Qiagen #158910), DNA Hydration Solution (Qiagen #158914 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human primers were pre-validated Quantitect primers (Qiagen, Manchester, UK). Comparative quantification normalised target gene mRNA to β-actin (ACTB ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from human samples was extracted with PowerSoil Pro (Qiagen) on the QiaCube HT (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... the human Stress & Toxicity PathwayFinder RT2 Profiler™ technology (Qiagen), assessing expression of 84 stress response-related genes ...
-
bioRxiv - Immunology 2020Quote: ... Mouse and Human IFN I RT2 Profiler PCR Arrays (Qiagen) were performed and relative expression determined using the ∆∆CT method and normalized for 5 housekeeping genes according to manufacturer’s guidance.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Immunology 2023Quote: ... RNA from human PBMCs was isolated using RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol and 1 mM DTT) and recombinant TrcP was purified from clarified lysates using Ni-NTA resin (Qiagen) and gravity chromatography ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant plasmids for mouse vaccination were prepared using an EndoFree Plasmid Purification Kit (Cat# 12391, Qiagen, Hilden, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... All recombinant vectors were grown in XL1-Blue competent cells and extracted using QIAprep Spin Miniprep kit (Qiagen, Germany) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein was extracted 48 hours post transfection with All Prep RNA/Protein Kit (Qiagen, USA). Protein concentrations were determined by Lowry assay (Bio-Rad ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: ... protein extraction was performed using the Allprep RNA/Protein Kit (80404 Qiagen Inc., Hilden, Germany). Proteins (10–20 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... and protein extraction were performed according to manufacturer instructions (AllPrep DNA/RNA/Protein minikit; Qiagen). Each spin column flowthrough (DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was isolated from powdered tissues using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). Protein pellets were lysed in HES-SDS buffer (20 mM HEPES [pH 7.4] ...
-
bioRxiv - Cell Biology 2023Quote: Cells were collected for total protein using Qproteome Mammalian Protein Prep Kit (Cat. 37901, Qiagen). Lysates were quantified for protein expression utilizing the WES system (ProteinSimple ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were then stained by Coomassie-blue or immunodetected as described before [26] using primary polyclonal antibodies directed against His6 epitope-tag (Penta His, Qiagen, dilution 1:1000), V5 epitope-tag (Bethyl Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Genomics 2021Quote: ... The fragmented and labeled DNA samples were purified from excess nucleotides using “QIAquick PCR Purification Kit” columns (QIAGEN), according to manufacturer’s recommendations.
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The expression construct was transformed into DH10MultiBacY cells and recombinant bacmid was purified with a QIAprep Spin Miniprep Kit (Qiagen). V0 and V1 virus generation was performed using SF9 cells as previously described 44 ...
-
bioRxiv - Cell Biology 2021Quote: ... The lysate was cleared via centrifugation and recombinant PfCen3-6xHis were purified from the soluble fraction using Ni-NTA agarose beads (QiaGen) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... cells were either left untreated or treated with 1000 IU/ml recombinant IFN-α treatment and incubated for 6 h or transfected overnight with polyI:C (10 μg/ml) using Polyfect (Qiagen). Luciferase assays were carried out ...
-
bioRxiv - Molecular Biology 2023Quote: ... the large stocks of recombinant T/F LTR-pGL3 reporter plasmids were generated using Plasmid Maxi kit (Qiagen, Valencia, CA) for immediate use or longer storage at -80 °C.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Molecular Biology 2023Quote: Total proteins from P5 hippocampi were purified with AllPrep DNA/RNA/Protein Mini Kit (Qiagen, 80004). The protein pellets were then resuspended in 90 μl Buffer ALO (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Physiology 2020Quote: ... protein was extracted (Qiagen Tissue Lyser) from ∼50 mg frozen liver in tissue lysis buffer 80 ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL Protein Precipitation Solution (QIAGEN) was added ...
-
bioRxiv - Cancer Biology 2023Quote: Advanced Protein Purification buffer (APP; Qiagen): the APP buffer contains zinc chloride to precipitate protein at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and The Protein Complex Suite (Qiagen). One microliter of 4.6 mg/ml protein sample suspended in crystallization buffer (25 mM Tris-HCl ...
-
bioRxiv - Genomics 2019Quote: ... 750ng of the gDNA was labeled using DLE-1 enzyme and reaction mix followed by Proteinase K digestion (Qiagen). The DNA back bone was stained after drop dialysis ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-sense DIG-labeled RNA probes were generated by in vitro transcription and purified with the RNeasy kit (Qiagen). At 55-62°C ...