Labshake search
Citations for Qiagen :
351 - 400 of 2654 citations for Recombinant Human Catenin cadherin associated protein Beta 1 88kDa His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 µg/mL anti-Penta-His-Alexa Fluor 488 (Qiagen), which recognized the His-tag on PXDN-con4 ...
-
bioRxiv - Immunology 2020Quote: ... immunoplates were coated with 0.125ug of Tetra-His antibody (34670; QIAGEN) followed by 2 ug/ml and 5 ug/ml of soluble RBD and NP ...
-
bioRxiv - Neuroscience 2020Quote: ... cultured and then isolated using a Hi-speed Midiprep kit (Qiagen). Expression was first examined by transfection of N2A cells in vitro ...
-
bioRxiv - Cell Biology 2021Quote: ... and His6- Vps4 was detected using Penta-His Antibody (Qiagen, Germany) per manufacturer instruction ...
-
bioRxiv - Microbiology 2022Quote: ... Antibodies against His-tag and S-tag were purchased from Qiagen and GenScript respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... Alexa Fluor 647-conjugated Penta-His mAb was purchased from Qiagen, Germantown ...
-
bioRxiv - Microbiology 2019Quote: His Tag-Alexa 647 (5 ug/mL) (Qiagen, catalog no. 35370)
-
bioRxiv - Cell Biology 2021Quote: ... was from List Biological Laboratories and the mouse monoclonal antibody against the His-tag from Qiagen.
-
bioRxiv - Biophysics 2022Quote: The following anti-His fluorophore-conjugated antibodies were purchased from Qiagen and used in UV-Bind assays for His-tagged proteins ...
-
bioRxiv - Microbiology 2022Quote: ... the membrane was treated with Penta-His MAb (Qiagen, Germantown, MD) followed by HRP-conjugated goat anti-mouse IgG (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound PEX5L was detected immunologically using monoclonal Anti-His Antibodies (Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol and 1 mM DTT) and recombinant TrcP was purified from clarified lysates using Ni-NTA resin (Qiagen) and gravity chromatography ...
-
bioRxiv - Immunology 2022Quote: ... Antigen specific B cells were gated with CD19+/IgM-/IgD-/Ghost dye-/PE+/BV605+ and sorted in catch buffer B (Qiagen TCL Buffer + 1% beta mercaptoethanol) by one cell per well in a 96 well plate ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Genomics 2021Quote: ... Then 37.5μl of beta-mercaptoethanol (0.375% final) and 10μl RNAse A (Qiagen® 100mg/mL) were added ...
-
bioRxiv - Genomics 2019Quote: All pathway and biological process enrichment analyses and SE-associated gene categorizations were conducted using Ingenuity® Pathway Analysis Software (QIAGEN).
-
bioRxiv - Microbiology 2023Quote: ... Skin and intestinal samples were handled aseptically and skin-associated DNA was extracted using a NucleoSpin Soil Extraction Kit (Machery-Nagel GmbH, Düren, Germany) while the intestine-associated DNA was extracted using MoBio DNA Extraction Kit (QIAGEN, Hilden, Germany) both as described (Hamilton et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA and chromatin-associated RNA from HeLa cells and total RNA from differentiating motor neurons were extracted using the miRNeasy kit (Qiagen, 217004) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... Gene expression of 96 fibrosis-associated genes were evaluated using a PCR array kit (RT² Profiler™ PCR Array Rabbit Fibrosis PANZ-120Z, Qiagen) by quantitative real-time PCR using a Thermal Cycler (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... Gene expression of 84 heat shock genes in mock-infected or 229E-infected cells was analyzed using Human Heat Shock Proteins & Chaperones RT2 Profiler PCR array (Qiagen). Real-time PCR analyses were performed with specific primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were fixed at indicated time points after warming and then processed for immuno-identification of HPK using an antibody that recognizes the polyhistidine tag (RGS-His antibody; Qiagen 1:100) and counterstained for nuclei using DAPI ...
-
bioRxiv - Biochemistry 2021Quote: ... Electroblotted membranes were incubated with penta-His antibody (Qiagen, Valencia, CA, USA). The antigen–antibody complex was visualized with alkaline phosphatase-linked to anti-rabbit IgG followed by staining with 5-bromo-4-chloroindol-2-yl phosphate and nitro blue tetrazolium [36].
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Molecular Biology 2022Quote: ... the His-SUMO conjugates were enriched using nickel-nitrilotriacetic acid beads (Qiagen). Upon multiple washing steps ...
-
bioRxiv - Biochemistry 2021Quote: ... The primary and secondary antibodies used were anti-penta His (Qiagen #34660) and goat anti-mouse IgG (LiCOR #926-68070 ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Microbiology 2019Quote: ... His-cyAbrB1 was purified with the Ni-NTA Fast Start kit (Qiagen). The elution fractions containing the purified protein were loaded onto a PD MidiTrap G-25 column (GE healthcare ...
-
bioRxiv - Plant Biology 2019Quote: ... His-NaERF2-like were expressed and purified with Ni-NTA agarose (QIAGEN). Biotin labeled probe EM13 (5’-tagattATCTaattctact-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... a conjugate of mouse monoclonal penta-His antibody and horseradish peroxidase (Qiagen) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transiently transfected with HA-tagged RILP or ORP1L constructs using Effectine (Qiagen), harvested at 24 hours post-transfection and fixed in 3.7% formaldehyde in PBS for 15-20 min ...
-
bioRxiv - Microbiology 2020Quote: ... His6-tagged Lem27 or its truncation mutants was purified using Ni2+-NTA columns (Qiagen). After washing with a buffer (50 mM Tris-HCl ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were then stained by Coomassie-blue or immunodetected as described before [26] using primary polyclonal antibodies directed against His6 epitope-tag (Penta His, Qiagen, dilution 1:1000), V5 epitope-tag (Bethyl Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... Western blot analysis was performed using the Penta His HRP conjugate kit (Qiagen). To check for equal loading ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP was first isolated using Ni-NTA beads (Qiagen, Valencia, CA) using a buffer with an imidazole gradient (20 mM Bis-Tris ...
-
bioRxiv - Biophysics 2019Quote: ... Anti-tetra-His-tag mouse monoclonal antibody (mAb) IgG1 was purchased from Qiagen Com ...
-
bioRxiv - Biochemistry 2021Quote: Assay mixes consisted of 25 nM ALEXA488-conjugated penta-His antibody (Qiagen # 35310), 50 μM DTT ...
-
bioRxiv - Microbiology 2022Quote: ... His-Hcp was purified from the soluble fraction by NTA-resin chromatography (Qiagen). Purified protein was desalted with a PD-10 desalting column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2024Quote: rEDA was produced intracellularly using the pQE-30 His tag purification system (Qiagen) in E ...
-
bioRxiv - Biochemistry 2021Quote: ... His6-tagged AC was secreted into the medium and purified by nickel affinity chromatography (Qiagen) with elution in 100 mM citrate pH 4.0.
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed in RLT (with 143mM beta-mercaptoethanol) and RNA purified using the RNeasy kit (Qiagen). 0.8-2μg of RNA were reverse transcribed using the High-Capacity cDNA reverse transcription kit and quantitative real-time PCR was carried out with the ViiA 7 Real-time PCR system (both Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant plasmids were purified with EndoFree Plasmid Maxi Kit (12362, QIAGEN). Oligonucleotide sequences and further details are provided in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Uhrf1 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 40,920 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Swi6 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 45,330 cm-1 M-1) ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant HCMVs were reconstituted from HCMV BAC DNA by Superfect (Qiagen) transfection into permissive MRC-5 cells.
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...