Labshake search
Citations for Qiagen :
601 - 650 of 975 citations for Recombinant Human CSH1 CSH2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN). After pelleting by centrifugation for 5 minutes at 5,000 x g ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Biochemistry 2022Quote: ... high molecular weight genomic DNA (gDNA) was purified from human primary T cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Immunology 2023Quote: Real-time quantitative PCR (RT-qPCR) was done as previously described [Zonneveld 2021] using the Human T cell Tolerance & Anergy RT2 Profiler PCR array (Qiagen). The relative expression levels of each gene were normalized using 4 reference genes (B2M ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were purified by immobilized metal affinity chromatography according to the manufacturer’s protocol (Qiagen), followed by gel filtration in 50 mM sodium citrate buffer (pH 5.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The proteins were first purified by chromatography on a Ni-NTA agarose column (QIAGEN), and then further purified on a HiTrap Heparin column (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were digested with 30 μL of Proteinase K II (QIAGEN, GmbH, Hilden, Germany). DNA was washed with AW1 and AW2 buffers (QIAGEN ...
-
bioRxiv - Biophysics 2019Quote: ... The protein present in the supernatant was purified using a Ni-NTA column (Qiagen). The protein was eluted by increasing the concentration of imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... proteins were blotted onto PVDF membrane and examined with an RGS-His4-antibody (Qiagen) and a 1:2500 dilution of the fluorophore-conjugated secondary antibody Cy3 (ECL Plex goat-α-mouse IgG-Cy3 ...
-
bioRxiv - Biochemistry 2020Quote: ... The target proteins were purified by affinity chromatography using a Ni-NTA column (Qiagen) with the lysis buffer supplemented with 20 mM and 200 mM imidazole serving as the washing buffer and elution buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... The soluble hEKL proteins were purified using a Ni-NTA agarose resin (Qiagen, Germany) and subsequently HiLoad 16/60 superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Bioengineering 2020Quote: ... The soluble protein fraction was then purified with pre-equilibrated Ni-NTA resin (Qiagen), recovered in elution buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was purified by affinity chromatography using Ni-NTA agarose (Qiagen, Hilden, Germany), followed by gel filtration chromatography ...
-
bioRxiv - Cell Biology 2021Quote: ... We purified the 6xHIS fusion protein on nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, CA) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... and proteins were purified by IMAC using Ni-NTA spin columns (QIAGEN, Hilden, Germany). Proteins were eluted in 100 μL elution buffer (50 mM sodium phosphate pH 8.0 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Uncleaved protein with 6xHisTag were isolated from the lysate using Ni-NTA resin (Qiagen). The flow-through (FT ...
-
bioRxiv - Biophysics 2019Quote: ... Proteins were purified by immobilized metal affinity chromatography according to the manufacturer’s protocol (Qiagen), followed by gel filtration in 10 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Bioengineering 2019Quote: ... The secreted protein was purified from the supernatant using Ni-NTA agarose resin (Qiagen) as previously described46 ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... His-βC1 fusion proteins were purified using Ni-nitrilotriacetate (Ni-NTA) agarose (Qiagen, 30210) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-tagged proteins from the supernatant were incubated overnight with Ni-NTA agarose (Qiagen) at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Network analysis of identified proteins was then performed using Ingenuity Pathway Analysis software (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... and associated protein network by using Ingenuity® Pathway Analysis (IPA) software (QIAGEN Inc.), relying on IPA’s proprietary algorithm to evaluate and minimize sample source bias ...
-
bioRxiv - Physiology 2021Quote: ... Total RNA was extracted from EVs (20 μg protein) using miRNeasy Mini Kit (Qiagen). RNA was then reverse-transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... The proteins were purified by affinity chromatography using a Ni-NTA agarose resin (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... The secreted protein in the culture supernatant was purified using Ni-NTA agarose (Qiagen) according to the manufacturer’s protocol and dialyzed against PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized for protein concentration and incubated with NiNTA agarose beads (Qiagen, #L30210) for O/N ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was purified using Ni-NTA agarose beads according to the manufacturer’s instructions (Qiagen). A buffer exchange was performed by centrifugation of the protein preparation through an Amicon Ultra-15 centrifugal filter unit (Millipore ...