Labshake search
Citations for Qiagen :
351 - 400 of 1096 citations for Recombinant Human CD79B protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... 750ng of the gDNA was labeled using DLE-1 enzyme and reaction mix followed by Proteinase K digestion (Qiagen). The DNA back bone was stained after drop dialysis ...
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-sense DIG-labeled RNA probes were generated by in vitro transcription and purified with the RNeasy kit (Qiagen). At 55-62°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... washed twice in PBS and DNA was labeled with propidium iodide (50 μg/ml) in presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.1%) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA was labeled with propidium iodide (50 μg/ml) in the presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.01% ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted from the allantoic fluid of recombinant and wild type after the first and fifth passages in eggs using the QIAamp® Viral RNA Mini Kit (Qiagen). The real-time qRT-PCR was performed using SuperScript™ III Platinum™ One-Step qRT-PCR Kit to detect NDV M gene41 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The recombinant plasmid was then purified at a high concentration (200 μg/mL) using the plasmid preparation kit (Qiagen, Germantown, MD).
-
bioRxiv - Immunology 2024Quote: ... Genomic DNA from the pooled recombinants and parent strain were isolated using the Gentra® Puregene® DNA isolation kit (Qiagen) and sent for whole genome sequencing (BGI) ...
-
bioRxiv - Genomics 2019Quote: ... genomic DNA and protein using AllPrep DNA/RNA/Protein Mini Kit according to the manufacturer’s instructions (Qiagen). Stable and Dox-inducible expression cell line was generated by transfecting the indicated PiggyBac vectors in the presence of hyperactive transposase plasmid (hyPBase ...
-
bioRxiv - Neuroscience 2020Quote: ... total RNA and proteins were recovered by using the Allprep DNA/RNA/Protein Mini Kit (Qiagen 80004). The efficiency of Cre-induced recombination in Appflox/flox mice was verified by PCR with primers F ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein and RNA extraction was done using Qiagen AllPrep DNA/RNA/Protein isolation kit (Qiagen Inc, USA). RNA purity was confirmed with 260/280 OD ratio using Nanodrop reader (Thermo Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... some samples were lysed for total protein extraction using Qproteome Mammalian Protein Prep Kit (Qiagen, Hilden, Germany). Western blot was done using capillary electrophoresis based system Wes™ (ProteinSimple ...
-
bioRxiv - Genetics 2022Quote: RNA from human ileal biopsies was extracted using RNeasy Mini Kit (Qiagen). 500 ng of RNA was reverse transcribed to cDNA using TaqMan Reverse Transcription kit (#N8080234 ...
-
bioRxiv - Cell Biology 2022Quote: FASTQ files generated by sequencing human macrophages were imported into ArrayStudio (Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were applied to the Human Aging RT2 Profiler PCR arrays (Qiagen) and run on Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Molecular Biology 2019Quote: Human islet RNA was extracted using the Qiagen RNeasy Kit (Qiagen; #74106) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: Human skin tissues were homogenized with RLT buffer (Qiagen, Hilden, Germany, 79216) supplemented with 1% β-mercaptoethanol (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for human ZMPSTE24 Hs_ZMPSTE24_1_SG QuantiTect) were predesigned and validated by QIAGEN and used diluted to a final work solution of 1x (QuantiTect Primers ...
-
bioRxiv - Developmental Biology 2023Quote: FlexiTube siRNA was used to knock-down human PDE2A (Cat#: SI00040159, Qiagen). AllStars Negative CTRL siRNA was used as control (Cat# ...
-
bioRxiv - Cell Biology 2024Quote: ... serially diluted matching human PCR amplicons cloned into the pDrive vector (Qiagen) were used to generate a standard curve ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (LNA oligonucleotides targeting FLAP X and FLAP Y labeled with TYE 563, Qiagen) were pre-hybridized in either 100μL of 1X SSC for conventional smiFISH ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng DNA was random prime labeled (ENZO) with Cy3 (Sample DNA) or Cy5 (Input DNA) and purified on a MinElute PCR purification column (Qiagen). Labeled DNA was diluted in hybridization buffer (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (TYE 563 labeled LNA oligonucleotides targeting FLAP X and FLAP Y, Qiagen) were pre-hybridized in 100 μL of the following buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... were amplified using biotin-labeled primers (Supplementary Table 2) synthesized by Sangon Biotech (Shanghai, China) and purified by a PCR purification kit (Qiagen). The EMSA was conducted as described previously(An et al. ...
-
bioRxiv - Microbiology 2020Quote: ... and a portion of the tissue (0.08-0.3g) was placed into pre-labeled microcentrifuge tubes containing 5 mm stainless steel beads (Qiagen Inc., CA). Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... SiCBL4 and SiCBL7 promoters were respectively amplified using biotin-labeled primers (Table S1) synthesized by Sangon Biotech (Shanghai China) and purified using a PCR purification kit (Qiagen). EMSA was conducted using a LightShift Chemilumniescent EMSA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Then this amplified product was labeled with biotin at 5’ end followed by purification using the Qiaquick nucleotide removal kit (QIAGEN).To check the drug-protein interaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digoxigenin-labeled LNA probes against mito-tRNA Asn and nuclear-encoded tRNA Asn designed by Qiagen (sequences in supplementary methods) were boiled for 2 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins from HGCC cells and GBM tissue were extracted with the AllPrep DNA/RNA/Protein Mini Kit (Qiagen).
-
bioRxiv - Neuroscience 2019Quote: ... RNA and protein were extracted for ECM composition analysis using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen). RNA was processed with the QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2019Quote: ... To summarize the cellular locations and protein classes the protein list was annotated using Ingenuity Pathway Analysis (Qiagen).
-
bioRxiv - Microbiology 2020Quote: The RNA genomes of recombinant MeV in P2 or P10 were isolated from infected Vero cells using the QIAamp Viral RNA Mini Kit (QIAgen, Hilden, Germany) according to the manufacturer’s instructions and resuspended in 50 μL RNase-free water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 250 μl of Protein Precipitation Solution (QIAGEN) was added to each sample and were incubated on ice for 5 min followed by vigorous vortexing for at least 30 sec ...
-
bioRxiv - Molecular Biology 2021Quote: ... For protein purification Ni-NTA agarose (Qiagen) was used ...
-
bioRxiv - Genomics 2020Quote: ... 333 μL of Protein Precipitation Solution (Qiagen) was added to each sample which was then vortexed and then centrifuged at 2000 x g for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified by Ni-NTA (Qiagen) and eluted with 300 mM Imidazole ...
-
bioRxiv - Cell Biology 2021Quote: AllPrep DNA/RNA/Protein Mini Kits (Qiagen) were used to extract total proteins from UVA-exposed and non-exposed HTEpC from all experiments ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... For protein purification using NiNTA agarose (Qiagen), cells were lysed in 50 mM phosphate buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... and 20 µL Protein Kinase K (Qiagen) for 30 min at RT followed by the steps as described in the protocol of Dneasy Blood & Tissue Kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of Buffer A ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were bound to Ni-NTA (Qiagen), washed with 10 column volumes of Buffer A ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was precipitated in 80% ethanol and Automated Protein-Aggregation Capture (PAC) was performed on a BioSprint-96 (Qiagen) according to the following method ...
-
bioRxiv - Genomics 2021Quote: ... We checked ASOs penetration in cells by means of the 5′-FAM-labeled control ASO A provided by Qiagen (Figure S5f).
-
bioRxiv - Genomics 2019Quote: ... and human genomic DNA (extracted from cells with DNeasy Blood & Tissue Kit, Qiagen). One guide was used with the plasmid ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared using the QIASeq Human Comprehensive Cancer Panel Kit (Qiagen #333515) and sequenced on an Illumina HiSeq 2500 or NovaSeq 6000 ...
-
bioRxiv - Pathology 2019Quote: Total RNA of human podocytes was extracted per manufacturer’s instructions (Qiagen, Germantown, MD) and 1 μg RNA was used for cDNA synthesis (Transcriptor first strand cDNA synthesis kit ...