Labshake search
Citations for Qiagen :
601 - 650 of 10000+ citations for Rat N acylethanolamine hydrolyzing acid amidase NAAA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... the supernatant was added to 2 ml of pre-equilibrated Nickel-nitrilotriacetic acid (Ni-NTA) agarose (QIAGEN, Cat. No. 30210) 50% slurry and rotated at 4°C for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Biochemistry 2019Quote: ... and the lysate was mixed gently with 4 ml (50% slurry) of nickel-nitrilotriacetic acid (Ni-NTA)-agarose resin (Qiagen) at 4°C for 1 h ...
-
bioRxiv - Plant Biology 2019Quote: ... Supernatant was applied twice to a column containing a gel bed of 2 ml nickel-nitriloacetic acid agarose (Qiagen, www.quiagen.com) equilibrated with lysis buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purification of p53-(1-73) from the clarified cell lysate was accomplished using a Nickel Nitrilotriacetic Acid (Ni-NTA, Qiagen) column purification and 50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: His-FlhAC and His-FlgN were purified by Ni affinity chromatography with a nickel-nitriloacetic acid (Ni-NTA) agarose column (QIAGEN) as described previously12 ...
-
bioRxiv - Physiology 2021Quote: ... We infected Sf9 cells with the recombinant virus to express and purify the His-tagged proteins using a nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) column ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Biochemistry 2021Quote: ... The soluble extracts were applied to 2-ml columns of nickel-nitrilotriacetic acid- agarose (Ni-NTA) (QIAGEN catalog no. 30210) that had been equilibrated with lysis buffer without protease inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the relative amino acid content of SLPMh were calculated using the CLC Main Workbench 20.0.1 (QIAGEN, Aarhus, Denmark). Conserved domains in the amino acid sequence of SLPMh were identified based on hidden markov models via the HHPred server (Söding et al. ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... The cleared lysate was applied to an affinity chromatog-raphy column containing Ni-nitrilotriacetic acid (NTA) su-perflow resin (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The protein was purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). A polyclonal rabbit antiserum was raised by Labcorp Early Development Laboratories Inc ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Neuroscience 2023Quote: ... primary hippocampal neurons were transfected in duplicates or triplicates using 150ng of a plasmid carrying enhanced GFP-gene in combination with 5nmol Power Lock-Nucleic Acid inhibitors (Qiagen) against miR-218-5p ...
-
bioRxiv - Biochemistry 2023Quote: ... Soluble protein was purified using immobilized-metal affinity chromatography (IMAC) by application of the cleared supernatant to nickel-nitrilotriacetic acid (NTA) beads (Qiagen) in a gravity flow column (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... equal amounts (200 µl) of FruK and Cra cell lysates were mixed with 100 µl of nickel-nitrilotriacetic acid beads (Qiagen). After overnight incubation at 4°C with gentle rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant protein was partially purified by affinity chromatography on nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com). Purification steps were carried out as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The kits for RNA extraction were from Qiagen (RNeasy Mini Kit and RNeasy Micro Kit). The reverse transcription kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Between 100 mg and 200 mg of young leaves were ground in liquid nitrogen in a Qiagen Retsch Tissue Lyser (Qiagen N. V., Hilden, Germany) during 2×1 min at 30 Hz ...
-
bioRxiv - Neuroscience 2020Quote: ... 50µL aliquot was added to 350µL of Supplemented RLT Lysis Buffer and stored O/N at −80 to generate the input fraction of the homogenate (Qiagen Cat. 74034, Hilden, Germany). Mouse monoclonal HA-specific antibody (2.5 µL ...
-
bioRxiv - Neuroscience 2021Quote: ... Using a commercial kit (QIAGEN DNeasy isolation kit #69506), DNA was isolated from a tissue punch taken from the external ear ...
-
bioRxiv - Microbiology 2023Quote: ... using a commercial kit (RT2 First Strand Kit, Qiagen). Quantification of transduction of EBECs and HBECs with the SARS-CoV-2 pseudovirus was determined by real-time qPCR (rt-PCR ...
-
bioRxiv - Microbiology 2023Quote: ... and the RNeasy kit plus Mini kit (#74134, Qiagen) or using NucleoSpin RNA Plus XS ...
-
bioRxiv - Cell Biology 2019Quote: ... and we used a Rat cAMP/Ca2+ PathwayFinder RT2 Profiler PCR Array System following the manufacturer’s instructions (SABioscience, Qiagen, version 4.0, Cat# PARN-066Z). In this case ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant containing solubilized protein was filtered using a 0.22 μM nylon membrane filter and incubated with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germantown, MD) at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... double-digoxigenin locked nucleic acid probe (RNO-MIR-124-3P: CATTCACCGCGTGCCTTA, Tm: 84°C, 339111 YD00614870-BGC, miRCURY LNA™ miRNA Detection Probe, Qiagen) was used at a final concentration of 30 nM ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were washed twice in PBS and incubated for 20 min at 54 °C (60 min at 52 °C for tissue sections) in mercury locked-nucleid acid (LNA) miRNA ISH Buffer 80 nM hybridiziation buffer (100 nM for tissue section) (Qiagen, 339450). Digoxigenin labeled miRCURY LNA probes (HSA-MIR-10B-5P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatant was divided into two parts: one part was directly combined with nickel-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen, China); the other part was heated in a 65 °C water bath for 60 minutes and then centrifuged at 14000 rpm for 60 minutes ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid was transfected to 293T cells and the recombinant S protein trimers were purified by Ni-NTA (nickel-nitrilotriacetic acid) chromatography (QIAGEN, Germany), followed by size exclusion to further purify the trimers ...
-
bioRxiv - Microbiology 2022Quote: ... nucleic acid extractions were performed by combining equal amounts of cell culture supernatants with RLT Lysis Buffer (Qiagen, Germantown, MA, USA), with 200 µL of the lysate used for magnetic bead-based extraction according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was adjusted to 500 mM NaCl and 20 mM imidazole before affinity purification by incubation with nickel-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, 30210) for 90 min at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: Lysates of His-tagged α-catenin WT and Δmod were bound to Ni-NTA (Ni2+-nitrilotriacetic acid)-sepharose affinity chromatography (Qiagen), washed with 50 mM Tris pH 7.8 ...
-
Macrodomain Mac1 of SARS-CoV-2 Nonstructural Protein 3 Hydrolyzes Diverse ADP-ribosylated SubstratesbioRxiv - Biochemistry 2023Quote: ... Frozen cells were thawed on ice and used for protein purification with nickel-nitrilotriacetic acid (Ni-NTA) Fast Start column as recommended by the manufacturer (Qiagen, Germany). The bound proteins were eluted from the column with elution buffer containing 50 mM NaH2PO4 ...
-
bioRxiv - Genetics 2019Quote: ... DNA maxiprep kit was from Qiagen (EndoFree Plasmid Maxi Kit). All plasmids were cloned with Gibson assembly (42 ...
-
bioRxiv - Cell Biology 2021Quote: ... QIAquick PCR purification kit or QIAquick Gel Extraction kit (Qiagen). Cloning strategies for each construct are described in Table S1 ...
-
bioRxiv - Genetics 2022Quote: ... we used the QIAGEN kit (DNeasy Blood & Tissue Kit; Qiagen, https://www.qiagen.com/ ...
-
bioRxiv - Neuroscience 2024Quote: ... QIAfilter Plasmid kits (Midi prep kit; Qiagen; catalog no.: 12243) were utilized to purify plasmid DNAs following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Kit (Qiagen, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... Transcription kit (Qiagen) and prepped for RT-PCR using PIPETMAX (Gilson ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription Kit (QIAGEN). qPCR was performed on the StepOne™ system (Applied Biosystems ...