Labshake search
Citations for Qiagen :
651 - 700 of 1566 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was purified using a QIAprep Miniprep kit (Qiagen) or a ZymoPURE II Plasmid Midiprep kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2022Quote: ... plasmid DNAs were purified using QIAprep Spin Miniprep Kit (QIAGEN) and subjected to Sanger sequencing (GeneWiz ...
-
bioRxiv - Biochemistry 2019Quote: ... Plasmids were obtained using the QIAPREP Spin Miniprep Kit (QIAGEN) and screened by digestion with BamHI (New England Biolabs ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... purified with an EndoFree plasmid kit (Qiagen, Valencia, CA, USA), and resuspended in 71 mM sterile PBS ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmid DNA was purified using QIAprep spin miniprep kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All plasmids were purified using QIAprep spin Miniprep kit (Qiagen) and sequence verified by Sanger sequencing in Eurofins Genomics ...
-
bioRxiv - Immunology 2020Quote: ... were purified using the Endo-Free Plasmid Maxi Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (Qiagen). Sanger sequencing was performed by Retrogen (San Diego ...
-
bioRxiv - Bioengineering 2021Quote: ... All prime editor plasmids were prepared by EndoFreeMaxi kit (Qiagen) and were delivered through hydrodynamic tail-vein injection ...
-
bioRxiv - Biochemistry 2020Quote: ... prepared with EndoFree plasmid MEGA prep kit (Qiagen, Valencia, CA), at the SAIC Advance Research Facility (Frederick ...
-
bioRxiv - Synthetic Biology 2021Quote: ... All plasmids were purified using QIAprep spin Miniprep kit (Qiagen) and sequence verified by Sanger sequencing in Eurofins Genomics ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmid purification was performed using QIAprep Spin Miniprep Kits (Qiagen). Phusion High-Fidelity PCR Master Mix with HF Buffer (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... Plasmids were purified using QIAprep Spin Miniprep Kit (Qiagen, 27104) and QIAGEN Plasmid Maxi Kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid purification was performed using QIAprep Spin Miniprep kits (Qiagen). Phusion high-fidelity PCR master mix with HF buffer (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid DNA was isolated with QIAprep Spin Miniprep Kit (QIAGEN) for the Y2H assay or Nuclebond® Xtra Midi (MACHERE-NAGEL ...
-
bioRxiv - Genomics 2021Quote: ... all plasmids were purified using QIAprep Spin Miniprep Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... plasmids miniprepped with the QIAprep® Spin Miniprep Kit (QIAGEN) and sequenced on both strands using the pJET1.2F and R primers provided in the cloning kit.
-
bioRxiv - Cell Biology 2020Quote: ... All constructs were amplified with a Plasmid Midi Kit (Qiagen). All constructs tested in this study ...
-
bioRxiv - Molecular Biology 2021Quote: ... All plasmids were isolated using QIAprep Spin Miniprep Kit (Qiagen), and all PCR products were purified with QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Miniprep DNA was isolated using QIAGEN Plasmid Mini Kit (Qiagen). shRNA sequences were confirmed by Sanger sequencing (performed by Quintara Biosciences).
-
bioRxiv - Cancer Biology 2020Quote: ... Miniprep DNA was isolated using QIAGEN Plasmid Mini Kit (Qiagen). sgRNA sequences were confirmed by Sanger sequencing (performed by Quintara Biosciences).
-
bioRxiv - Biophysics 2021Quote: ... Plasmid DNA was purified using QIAprep Spin Miniprep kit (QIAGEN) and sequenced to verify successful mutagenesis.
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (Qiagen) and the integration of the oligonucleotides pairs was assayed using Bbs1 digestion (plasmids with putative correct integrations remained circular following the enzymatic digestion) ...
-
bioRxiv - Immunology 2021Quote: ... or the endotoxin-free HiSpeed Plasmid Midi Kit (Qiagen 12643). All DNA extracts were quantified using UV spectrophotometry (NanoDrop™ -Thermo Scientific).
-
bioRxiv - Developmental Biology 2020Quote: ... Plasmids were isolated with the QIAprep Spin Miniprep Kit (Qiagen) following the instructions of the Quick-Start Protocol using a centrifuge for processing ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen). Standard procedures were used to perform routine cloning.
-
bioRxiv - Biophysics 2021Quote: ... was prepared using the EndoFree Plasmid Maxi Kit (Qiagen, France). For FRET-FLIM experiments ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids were extracted using anendotoxin-free kit (QIAgen Cat. #12362) and stored until ready to use.
-
bioRxiv - Developmental Biology 2022Quote: ... Plasmid DNA purification used an ultrapure DNA purification kit (Qiagen). BAC plasmid DNA was digested with Not I before analysis by pulse-field gel electrophoresis (Osoegawa et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid was isolated using QIAprep Spin Miniprep Kit (Qiagen 27104). All plasmids were sent to the Penn Genomic Analysis Core for sgRNA insertion validation by Sanger sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... the plasmid was extracted using a commercial extraction kit (Qiagen) and used to transform electrocompetent E ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (DH5α) and purified using the Plasmid Maxi Kit (Qiagen). Site-directed mutagenesis was used to introduce single nucleotide variants into the generated construct ...
-
bioRxiv - Genetics 2022Quote: ... and purified with the HiSpeed Plasmid Maxi Kit (#12663, Qiagen). Transient transfection was carried out in HEK293T cells transfected with 1 μg of plasmid DNA in the presence of X-tremeGene9 DNA transfection reagent (#6365809001 ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: ... Plasmids were extracted using the QIAGEN Miniprep kit (27106, QIAGEN) as per manufacturers’ instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated using spin columns (Qiagen Spin Miniprep Kit). The resulting plasmids were checked by Sanger sequencing ...
-
bioRxiv - Immunology 2022Quote: ... All plasmids were prepared using QIAprep mini spin columns (QIAGEN), and sequences were verified by Sanger sequencing using an ABI3770.
-
bioRxiv - Molecular Biology 2023Quote: ... then purified with QIAGEN Plasmid Plus Midi Kit (QIAGEN, 12943). Mutations were confirmed by sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (QIAGEN), and individual clones were sequenced at Microsynth using the IRES-rev primer (TATAGACAAACGCACACCG) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The plasmids of these colonies were purified via miniprep (Qiagen) and sequenced by SNPsaurus ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids and DNA fragments were purified using commercial kits (Qiagen). Elim Biopharmaceuticals synthesized custom oligonucleotides and provided Sanger DNA sequencing services.
-
bioRxiv - Synthetic Biology 2023Quote: ... The plasmids of these colonies were purified via miniprep (Qiagen) and sequenced by SNPsaurus ...
-
bioRxiv - Immunology 2023Quote: ... The plasmids were purified using QIAprep Spin Miniprep Kit (Qiagen), and their sequences were confirmed by Sanger sequencing (Genewiz) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Vectors were isolated using the plasmid miniprep kit (Qiagen, Germany). pURR expression vectors were transformed into E ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid libraries were recovered using a Midi prep kit (Qiagen). Lentiviral libraries were generated in HEK293T by transfection of plasmid libraries using lipofectamine 2000 (ThermoScientific ...
-
bioRxiv - Genomics 2023Quote: ... plasmids miniprepped with the QIAprep® Spin Miniprep Kit (QIAGEN) and sequenced on both strands using pJET1.2 primers.
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid DNA was prepared using the Mini Prep kit (Qiagen). Transgenic animals expressing an extrachromosomal array were created by gonadal microinjection of plasmids of interest with indicated co-injection marker into indicated strains in Table S6 ...
-
bioRxiv - Developmental Biology 2023Quote: Plasmids were purified using a MaxiPrep DNA isolation Kit (Qiagen). For virus packaging ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (QIAGEN), and individual clones were sequenced at Microsynth using a forward primer (GGCAAACAACAGATGGCTGGCAAC ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids were amplified with the QIAprep Spin miniprep kit (Qiagen) and linearized with Not1-HF (New England Biolabs) ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids were isolated using a bacterial miniprep kit (Qiagen, 27106). Nanobody sequences were determined by Sanger sequencing.